Gene ID2738
Gene NameHmuk_2738
Annotationpurine or other phosphorylase family 1( EC:2.4.2.3 )
Locationchromosome:2631048←2630230
Gene typeFunctional gene
GC content0.68
Hydropathicity-0.247426470588236
DNA (819 bp, Edit)ATGACCGACGACAGCGAAGATCCCAACGACGGCGAGCAGTACCACCTCGAAGTCGCGCCGGGCGACGTGGCACCCAGCGTCCTCCTGCCGGGCAACCCCGAGCGCGTCGCCAAGGTCGTCGAGTCCTGGGACGACCACGAGGTCGTCGCAGACCACCGAGAGTACCGCACGGCGACCGGGGAGTACGACGGAACGCCGATTTCGGTCACGTCGACCGGGATCGGTTCGCCCTCGGCAGCCATCGCCGTCGAAGAACTGGCTCGCGTCGACGCCGAGACGCTGCTCCGCGTCGGTTCCTGTGGCGCGATCCAGGAGCAGGCCAGCATCGGCGATCTGATCATCACCACGGGCGCGGTCCGACAGGAGGGAACCAGCGAGGAGTACGTCCGCGAGGACTACCCCGCGACCGCCGATCACCGCGTCGTCTCGGCGCTCGTCGCCGCCGCAGAGGAGTTAGGATACGACTACCACCTCGGACTGACCTGTTCGACGGACAGCTTCTACGCCGGCCAGTCACGGCCCGGCTTCGAGGGCTTCGAGGCCAGCGGGAGCGACGAGCGCATCGACGCACTCCGTGAGGCCGGCGTCCTCAACTTCGAGATGGAAGCCAGCGCCATCCTGACGCTGGCGAACCTCTACGGGCTCCGGGCCGGCGCGGTCTGTACGGTCTACGCCAACCGCGTCACCGGAGAGTTTCGCACGGAAGGAGAACGCAGGGCCGCAAAGACCGCGAGTCTCGCGATCGACTACCTCGCGCGGATGGACGCGGCCGTCGAAGCCAGCGACGCCGACCACTGGCACGCCGGCCTGTCGCTGTGA
E.C.#2.4.2.3
pI4.0763
MW (k)29004.7
Translation (271 aa, Edit)MTDDSEDPNDGEQYHLEVAPGDVAPSVLLPGNPERVAKVVESWDDHEVVADHREYRTATGEYDGTPISVTSTGIGSPSAAIAVEELARVDAETLLRVGSCGAIQEQASIGDLIITTGAVRQEGTSEEYVREDYPATADHRVVSALVAAAEELGYDYHLGLTCSTDSFYAGQSRPGFEGFEASGSDERIDALREAGVLNFEMEASAILTLANLYGLRAGAVCTVYANRVTGEFRTEGERRAAKTASLAIDYLARMDAAVEASDADHWHAGLSL