Gene ID2231
Gene NameHuta_2231
Annotationphosphoribosylformylglycinamidine synthase, purS
Locationchromosome:2278701→2278949
Gene typeFunctional gene
GC content0.67
Hydropathicity-0.451219512195122
DNA (249 bp, Edit)ATGAGTACCTACACCGCGACCGTGACTGTCCAGCTCAAGGAGGGGGTGCTCGATCCGGAGGCCGAGACCACCCGCGAGGCGCTCGAACGCCTCGGCTTCGAACTCGACGCGCTCCGGGCGGCAGACCGCTTCGAGATCGACCTGGAGGCAACCGATAGCGAGGCGGCCAGAGACCGCGTCGAGGAGATGGCCGAGCGCCTGCTCGCCAACCCGACCATCCACGACTACGAGGTCGCCGTCGAGCAATGA
pI3.9338
MW (k)9227.16
Translation (81 aa, Edit)MSTYTATVTVQLKEGVLDPEAETTREALERLGFELDALRAADRFEIDLEATDSEAARDRVEEMAERLLANPTIHDYEVAVEQ