Gene ID3806
Gene Nametp25
Annotationdrug/metabolite family transporter 25
Locationchromosome:1833446→1834396
Gene typeFunctional gene
GC content0.692954784437434
Hydropathicity1.00379746835443
DNA (951 bp, Edit)GTGAGTCTCCGTCGAGCGATAGGGCTGTTTGCTGTCGCCAGCCTCGCGTTCGGCGGCACGTTCGTCGCCGCCCGCGCCGGACAGGTCTACATCCCGCCGCTGCTTTTCGTCGCCATCCGGTTCGACCTCGCGGCGATACTCCTGCTCGGCTACGCCGCCTACGCGACCGAGGGCTCTATCCGCCCGCGAACGCGCGGCGACATCGGCGGCGTCCTCGCCGCCGGCGTGCTCACTATCGGGCTAGCAAACGGCCTGCTCTTTGTCGGGCAGGGGTACGTCACCAGCGCGGTCGGCGCGATTCTCTTCAGCCTCGTGCCCATCATCGCCCCGCTGTTTGCGGCCCTGCTGCTTTCCGACGAGCGAGTGTCAGCGCTCGGTGCCGTCGGGATGGGCGTTGCGGCCATCGGCGTCGGGATGGTCGTCGGCGTCTCGCCGAGCAATCTACTGGCCGAAAGCGGCGTTGGGGCGGCCCTCGTTCTCGGCGGCGCGGCCAGTGCCGCGCTCGGGACGGTGCTGACTCGCCGGTGTGAGGCGACGATTTCCAGCACCGCACAGGTCGCGTGGGGGCTTCCGATAAGCGCCGTGCTGCTCCACGGAATGAGCCTCGCGGTCGGCGAGTCGGCGGCCGCCATCGAGTGGACGCTCACCGCCATCGTCTCACTCGCCTACGTCACGGTCGTTGCCGGCGCAGTCGGCTACATCGCCTACTTCGCGCTCATCGAGGAGGTCGGGGCGCTGCGGTCCAGCCTCATCTTCTACGCCAGCCCGCTCGTGGCCGCGCTCGGTGGCTGGTGGTTCCTCGGTGAAGCCATCACCACGACGACGGTCGCCGGATTCGTCACCGTCGTTGCCGGCTTCCTCGTCATCGGCCACGAGCAGTTCCGGGCGGCGTTCAGGCGGCTGGCAGACGGCCGCGGGCAGGCAACTGGCGGTTACGAGCCGAGCGACTGA
pI6.5281
MW (k)31891.3
Translation (315 aa, Edit)MSLRRAIGLFAVASLAFGGTFVAARAGQVYIPPLLFVAIRFDLAAILLLGYAAYATEGSIRPRTRGDIGGVLAAGVLTIGLANGLLFVGQGYVTSAVGAILFSLVPIIAPLFAALLLSDERVSALGAVGMGVAAIGVGMVVGVSPSNLLAESGVGAALVLGGAASAALGTVLTRRCEATISSTAQVAWGLPISAVLLHGMSLAVGESAAAIEWTLTAIVSLAYVTVVAGAVGYIAYFALIEEVGALRSSLIFYASPLVAALGGWWFLGEAITTTTVAGFVTVVAGFLVIGHEQFRAAFRRLADGRGQATGGYEPSD