Gene ID1780
Gene NameHmuk_1780
AnnotationAAA family ATPase, CDC48 subfamily
Locationchromosome:1703145←1700923
Gene typeFunctional gene
GC content0.65
Hydropathicity-0.402567567567567
DNA (2223 bp, Edit)ATGAACGAGGTTCAACTGGAGGTCGCGAAAGCGTACCCGAACGACTCGGGGCGCGGTATCGCTCGCCTGGATCCGGACACGCTCTTGCATCTCAAGCTCTCGCCCGGCGACATCATCGAGATCGAGGGAAGTGAGACCACCGCCGCGAAAGTGTGGCGTGCGGATCGACAGGACTGGAACACCGACACGGTGCGCATCGACGGTTTCACGCGACAGAACGCCGACGTGGGCATCGGCGAACGCGTGACGATCCGCAAGGCCGACGCCGAGAAGGCCGACAAGCTCGTGCTGGCTCCGCCGGAGGAAGCCAGCGTACAGTTCGGCTCGGACGCGGCCGGCATGGTCAAGCGCCAGATCCTCAAGCGCCCGGTCGTCGAGCGCGACATCGTCCCCGTAATGTCCAGTACGAACCACCCGTTCATGCGCTCGCCGGGCCAGGCGATCCCGCTGATCGCCGTCGAGACCGAGCCGGAGGGCGTCTGTCTCATCACCGAGGACACGGACGTGGAGTTGCGCGAAGAGCCCATCAGCGGCTTCGAGAAGACCGGCGGCGGCATCACCTACGAGGACATCGGCGGCCTCTCCAGTGAGATCCAGCGGGTCCGCGAAATGGTCGAGTTGCCGATGAAACACCCCCAGATCTTCAAGAAGCTCGGCATCGAGCCGCCACAGGGGGTGTTGCTCCACGGTCCACCGGGTACGGGCAAGACCCTGCTCGCGAAGGCCGTCGCCAACGAGACCTCCGCCAGTTTCTTTTCTATTGCCGGTCCGGAGATCATCTCGAAGTACTACGGCGAGTCCGAACAGCAACTCAGGGAGATCTTCGAGGACGCCAGCGAGGAGGCTCCCTCGATCATCTTCATCGACGAGCTAGACTCGATCGCGCCCAAGCGCGAGGACGTGACCGGCGAGGTCGAGCGCCGCGTCGTCGCCCAGCTGCTGACGATGATGGACGGTCTCGAATCACGCGGCCAGGTCATCGTCATCGCCGCGACCAACCGCGTCGACAGCGTCGACCCGGCACTGCGCCGGCCGGGCCGGTTCGACCGCGAGATCGAGATCGGCGTCCCCGACGAGGTCGGCCGCGAGGAGATCCTCCAGATCCACACCCGCGGGATGCCTCTCTCGGACGACGTGGCCCTCTCGAATCTGGCGACCGAGACCCACGGCTTCGTCGGTGCCGACATCGAGAGCCTGACCAAAGAGGCCGCGATGAAGGCGCTGCGTCGGTACCTCCCCGAGATCGACTTAGACGAGGAGGACATCCCGCCGAGCCTGATCGACCGCATGATCATCAAACGGGAGGACTTCCGCGGGGCCCTCAACGAGGTGAGTCCCAGCGCCATGCGGGAGGTGCTGGTCGAGCTCCCGAAGATCTCCTGGGACGACGTGGGCGGTCTCGACGACGCCAAAGAGCAGGTCCAGGAGTCCGTCGAGTGGCCGATGAACAGCCCGGAGAAGTTCGAGCGCATGGGCGTCTCACCGCCATCTGGCGTCCTGCTGTACGGGCCGCCGGGGACCGGAAAGACCCTGATGGCCAAAGCCGTCGCCAACGAGACTGACGCCAACTTCATCTCGGTGCGGGGACCACAGCTCCTCTCGAAGTGGGTCGGCGAGTCGGAGAAGGCGATCCGTCAGACCTTCCGGAAGGCCCGGCAGGTCGCACCGACGGTGATCTTCTTCGACGAACTCGACTCCCTCGCACCGGGACGTGGCGGCGAGACCGGGAGCAACGTTTCCGAACGCGTCGTCAACCAGCTGCTGACCGAACTCGACGGGCTCGAAGAGATGGAAGAGGTGATGGTGATCGGCGCGACCAACCGGCCGGACATGATCGATCCGGCACTGATCCGCTCGGGTCGGTTCGACCGGCTGGTGATGGTCGGCGAACCCGGTATCGAGGGCCGCGAGCAGATCCTCAAGATCCACACCGACGACACGCCGCTGTCGCCGGACGTGAGCCTGCGCGAACTCGCGGAGATGACCGACGGCTACGTCGGCTCCGACCTGGAGTCGATCGGCCGCGAGGCCGCCATCGAGGCGCTGCGCGAGGACGACGACGCCGAGATGGTCGAGATGAGGCACTTCCGGCAGGCCATGGAGAACGTGCGCCCGACGATCACCGACGACATCCGCGACTACTACGAGCAGATGCAAGACGAATTCAAGGGCGGCGGCGAACCCCAGCAGACCCGCGGTGGCGGCCGCATCGGCTTCCAGTAG
pI4.311
MW (k)81639.1
Translation (739 aa, Edit)MNEVQLEVAKAYPNDSGRGIARLDPDTLLHLKLSPGDIIEIEGSETTAAKVWRADRQDWNTDTVRIDGFTRQNADVGIGERVTIRKADAEKADKLVLAPPEEASVQFGSDAAGMVKRQILKRPVVERDIVPVMSSTNHPFMRSPGQAIPLIAVETEPEGVCLITEDTDVELREEPISGFEKTGGGITYEDIGGLSSEIQRVREMVELPMKHPQIFKKLGIEPPQGVLLHGPPGTGKTLLAKAVANETSASFFSIAGPEIISKYYGESEQQLREIFEDASEEAPSIIFIDELDSIAPKREDVTGEVERRVVAQLLTMMDGLESRGQVIVIAATNRVDSVDPALRRPGRFDREIEIGVPDEVGREEILQIHTRGMPLSDDVALSNLATETHGFVGADIESLTKEAAMKALRRYLPEIDLDEEDIPPSLIDRMIIKREDFRGALNEVSPSAMREVLVELPKISWDDVGGLDDAKEQVQESVEWPMNSPEKFERMGVSPPSGVLLYGPPGTGKTLMAKAVANETDANFISVRGPQLLSKWVGESEKAIRQTFRKARQVAPTVIFFDELDSLAPGRGGETGSNVSERVVNQLLTELDGLEEMEEVMVIGATNRPDMIDPALIRSGRFDRLVMVGEPGIEGREQILKIHTDDTPLSPDVSLRELAEMTDGYVGSDLESIGREAAIEALREDDDAEMVEMRHFRQAMENVRPTITDDIRDYYEQMQDEFKGGGEPQQTRGGGRIGFQ