Gene ID1762
Gene NameHmuk_1762
Annotationmulti-sensor signal transduction histidine kinase
Locationchromosome:1682937←1680445
Gene typeFunctional gene
GC content0.67
Hydropathicity-0.440963855421685
DNA (2493 bp, Edit)ATGACCCAGCCTGTGGACGGGATTCGAGTGCTCCACGTGGACCGCGACCCGCAGGTCCGACACGCCGTCGCGGCGCGGCTGGCAGACGACGACATCGTCGTCGAGAGCGTCTCGACCAGCGAGGCAGCCGTCGAGGAACTCGCCGACGGTCGGTTCGATTGCGTCGTCAGCGGCCACGACGAGTCTGCCCTCGACAGCGTCGCGCTCCTCGAAACCGTCCGCTCGGAGTATCCGGACCTTCCGTTCCTGCTGTGTACCGACGCCGGAAGTGAAGCGCTCGCCAGCGAGGCGGTCGCTGCCGGCGTCACCGAGTACCTCCCTCGCGACGGCGACGACGGGTATCGCGCGCTCGTGGATCGGGTCGAGCGAACGGTCTCTGAGTACAGAGCGACGACGCCGATCGAACGGCAAGAACAGCGCCTCTCGACGCTGGTGTCGAACCTCCCCGGAATGGTGTATCGCTGTCGAAACGAACCGGGCTGGCCGATGCAGTTCGTCAGCGCGGGAGTCCGGGAGCTGACCGGCTACGAGCCCGACGCCCTGGAGAGCGGACGGGTCGACTGGGAGACCGACGTGGTTCACCCCGAGGATCGCGACGACGTCCGGGAGGCGGTCCAGTCGGCACTCGACAGCGGCGAGCCCTTCGAAGTCACCTACCGGATCGAGACGGACGACGGGCAACGGCGGTGGCTGTGGGAGCGGGGCCAGTTGCTCACGCGCGACGACGAGACGGAGATTCTGGAGGGGTTTATGACGGACATCACGGCTCGCACGGAGCACCGCCGGGCGCTCGAAGAGCAGCGAGCGTACGTCGAGGACGTGTTGAACTCGCTCGAAGACCTCTTCTACGTCGTCACGCCCGACTGGTCGCTGCGCCAGTGGAACGAGCAGGTGGTCGACGTGACGGGATACAGCGACGAGGAGATCGCGGAGATGACTGCACTGGAGTTCATCGCTCCCGAGGACGTTCCCACGGTCGAAGCTGCCATCGAGCGTGCGATCGAGAGCGGCTCGTCGCGATACGAGGCCACGGTACAGACGAAGTCCGGCGAGACGATTCCCTACGAGTTCCACGGCACGGCGCTGTCGGACACGACCGGCGAGTTCCTCGGCATCGCCGGTGTGGGCCGTGACGTGTCCGAGCGCAAGGAGCGCGAACAGACGCTGCGCCAGTACGAGACGCTGGCCGAGAGCGTCGCGGACCCGATGTACGTGATGGCTCCCGACGGGACCATCGAGATGATCAACGACGCGCTGGCCGACCACATCGGCTACGAGCGGTCGGAGATCGTCGGAGCGTCGCCCGAGGAGTTCGTCGTCGGAGACGGCGTCGAACGGGCCGAGGAACGCATCCGCGAGCTGTTGACCACCGATCGAGACGTGGCGACCTTCGAGATGTGGACGGTCGACGACGACGGCGAGGAGACCTACAACGAGACGAAAATCGCCGTCATGACCGACGAAGACGGCGAGTTCGAGGGAACGGCCGGCGTCATCCGAGACATCACCGAGCGGACCGAACGCCAACGAGAGCTAGAGCGCTACGAGACGATCCTGCAGGCGGTTGGGGATCCCGTCTACACGCTCGACGCCGAAGGGCAGTTCACCGTCGTCAACGACGCGATGGAGGCGCTCTCGGGCTACGACCGCGATCGACTGATCGGCGAGCACATCTCGAAGCTGATGACCCCGGAAGACGTTGCGGCCGGGGAAGACCTCATCGCCGAACTGCTCGCCGACCCGGATCGGACGAACGGGACCTTCGAGATGGGACTCCAGACGGCCGACGGAACCCGGATCACCTGCGAGAACCACGTCGCCCTGCTGCCGGCCGACGACGGGCGGTTCAGAGGGACCGCCGGAGTCATCCGGGACATCAGCGAGCGCAAACAGCGGGAGCGACAGCTCGAACAGTTCGCCAGCGTCGTCAGCCACGACCTCCGGAGCCCGCTCAACGTCGTTCAGGGACGTGTCAACCACGCTATTGCGACCGGCGAGCTCGAACACCTCGACGACGCGGCCGACGCCGCCCATCGGATGGAAGCGCTCATCGGCGACCTCCTCACCCTCGCCCGCCAGGGACGGCGGGTCGGCGACCTCGAACCGGTCGCTCTCGACGTGGTCGCCCAGGCGGCCTGGTCGCAACTCGACGCCGACGAGAAGGATCTCGTCGCCGAGACCGACAGCCGCGTCGAGGCCGACTTCGACCGACTCCAGGAACTGTTCGACAACCTGTTTTGCAACGCGATCACCCACGGCGGAGCCGAGACGGTCCGCGTCGTCGACACCGACGACGGGTTCGCCGTCGTCGACGACGGGGACGGGATTCCGCCGAGCCAGCGTGAGACGATCTTCGAACGGGGGTTCACGACCAGCGAGGAGGGGACCGGATTCGGACTGGCGATCGTCGACACCATCGTGAGGGCTCACGACTGGTCGATCACGGTCGGACGAAGCGACGCGGGCGGTGCGCGCTTCGAGGTCACGACCTAG
pI3.9993
MW (k)92069
Translation (829 aa, Edit)MTQPVDGIRVLHVDRDPQVRHAVAARLADDDIVVESVSTSEAAVEELADGRFDCVVSGHDESALDSVALLETVRSEYPDLPFLLCTDAGSEALASEAVAAGVTEYLPRDGDDGYRALVDRVERTVSEYRATTPIERQEQRLSTLVSNLPGMVYRCRNEPGWPMQFVSAGVRELTGYEPDALESGRVDWETDVVHPEDRDDVREAVQSALDSGEPFEVTYRIETDDGQRRWLWERGQLLTRDDETEILEGFMTDITARTEHRRALEEQRAYVEDVLNSLEDLFYVVTPDWSLRQWNEQVVDVTGYSDEEIAEMTALEFIAPEDVPTVEAAIERAIESGSSRYEATVQTKSGETIPYEFHGTALSDTTGEFLGIAGVGRDVSERKEREQTLRQYETLAESVADPMYVMAPDGTIEMINDALADHIGYERSEIVGASPEEFVVGDGVERAEERIRELLTTDRDVATFEMWTVDDDGEETYNETKIAVMTDEDGEFEGTAGVIRDITERTERQRELERYETILQAVGDPVYTLDAEGQFTVVNDAMEALSGYDRDRLIGEHISKLMTPEDVAAGEDLIAELLADPDRTNGTFEMGLQTADGTRITCENHVALLPADDGRFRGTAGVIRDISERKQRERQLEQFASVVSHDLRSPLNVVQGRVNHAIATGELEHLDDAADAAHRMEALIGDLLTLARQGRRVGDLEPVALDVVAQAAWSQLDADEKDLVAETDSRVEADFDRLQELFDNLFCNAITHGGAETVRVVDTDDGFAVVDDGDGIPPSQRETIFERGFTTSEEGTGFGLAIVDTIVRAHDWSITVGRSDAGGARFEVTT