Gene ID3486
Gene Name
Annotationhypothetical protein
Locationchromosome:1683996←1682974
Gene typeHypothetical gene
GC content0.647116324535679
Hydropathicity-0.127647058823529
DNA (1023 bp, Edit)ATGAGCTCCGATAGTCGCTCGCTCGTCGGGGTTTTCGTGCTCGTCTTCGCAGTTACTGTCGGCGCTGTAGTCGTCGGTAGCATCGGCCTTGATATGGTCGGCGAACAGCCAGAGGTCGAAGAGGACCACTGGAACCTCGATGCAGTCGCCCCGGAGGGCGCTGAGACCGGTGGCGAAATCGCGATGGATAGCTTCGAGGCGGAAAACACCGTTGTCGTCCACGTGCCGCCGAGCGTCCCGGCCGGTGGTGGCATCGCCATGCCAATCGAAGACGACACCGACCTTGATGAAGCGTCTGTCGGCAGCATCGGCGGTGCCGAGCGCGATATCAGTCCGCTAGCGTCGACGCTCGCCGAGAACGGCCACGAGGTCGTCTTCTACCAAGACGAGTTTGAAGACGGCCCGCTCGACGAGACACTCGCCGAGGCGGACGGCTTCATTTCGACCGGTGTCGGAATGCTCTCCGGCGAGGAAACCGACGCCGTCGAGGAGTTCGCCGACTCCGGCGGCCGTGTCGTCCTTACCGCCAACCCCGGCAGCGCGGGTCCGGCCACCGACGTCGGCTCCTCGTTCGGCCTGTATGCTGACTTCGGCTACGTCTATGACATGGCCGAAAACGACCACAACTACCTGAGCGTCTTCGTTGAGCCGGCCGATGGCTCGCCGCTTACCGACGGCGTCGACCGGGCCGTCTTCCGCGGTGCCGCCCCCGTTGGGGCTTCGGACGGCAGCGGCACCTTCGAGACGAGCGATAGCGCACAGATTTCGACGACCCGCGAGACCGGCAGCTACACGGTCGCTGCGACCAGCGGCGATGTCGCCCTTGTCGGCGATTCGAGCTTCATGTCGCCCGAAAACGCCAAGCGAGCGGACAACAACGTGCTCGTCGGCAACGTCGCCGACTACCTCGTCACCGGCGGCCCCGTGACGATGGACCTCGATGACGATGACGAGCCCGAACCCGGCCCCGCACCACCTGGTGACCCTGATGATGATGTCGACGTAGAGCCGATTCAGCCGTAG
pI3.3309
MW (k)34822.5
Translation (339 aa, Edit)MSSDSRSLVGVFVLVFAVTVGAVVVGSIGLDMVGEQPEVEEDHWNLDAVAPEGAETGGEIAMDSFEAENTVVVHVPPSVPAGGGIAMPIEDDTDLDEASVGSIGGAERDISPLASTLAENGHEVVFYQDEFEDGPLDETLAEADGFISTGVGMLSGEETDAVEEFADSGGRVVLTANPGSAGPATDVGSSFGLYADFGYVYDMAENDHNYLSVFVEPADGSPLTDGVDRAVFRGAAPVGASDGSGTFETSDSAQISTTRETGSYTVAATSGDVALVGDSSFMSPENAKRADNNVLVGNVADYLVTGGPVTMDLDDDDEPEPGPAPPGDPDDDVDVEPIQP