Gene ID2789
Gene Name
Annotationhypothetical protein
Locationchromosome:2094285→2094734
Gene typeHypothetical gene
GC content0.502222222222222
Hydropathicity-0.704026845637584
DNA (450 bp, Edit)ATGAGCTATCCTGTGACGTATTATTGCCCACACTGTGGAGCTGTCGTAGAAGTTGAGCGCGAGGGCTACCTCGCTGATAAGTCAGTTACACCATATCCGCTTGAGGGATGGATATACACCGACCCACATGACTCAACAAATGTATCGTATGAGTCTGCTGATGGGATTCGATTTGTTTGTGGGGAAATACCATCAGAATTGGATACAGATCAGGCGACATCCGGAATCCGATGGACAGGCGATCGAAGCCCTGCAGATGATGTAGAAAATCCAGATATAACTAGCCCTTGCGGTCGCCCATTTTATCTCTCATTTGTTCGATTTGAGGATGGTACTGAAATTGAACCCCGACCTGACACTGACCGGGTTCGGATCGCCTCTGATACAGCAGGACCATCACAGCCAAACGGTCCAACTAGCCCAGACGGTCCGGGGGGATTCCGACGGTGA
pI4.069
MW (k)16369.8
Translation (148 aa, Edit)MSYPVTYYCPHCGAVVEVEREGYLADKSVTPYPLEGWIYTDPHDSTNVSYESADGIRFVCGEIPSELDTDQATSGIRWTGDRSPADDVENPDITSPCGRPFYLSFVRFEDGTEIEPRPDTDRVRIASDTAGPSQPNGPTSPDGPGGFRR