Gene ID3424
Gene Nameabc08s
Annotationbranched-chain/neutral amino acids amide ABC transporter periplasmic substrate-binding protein 4
Locationchromosome:1647433→1648776
Gene typeFunctional gene
GC content0.633184523809524
Hydropathicity-0.316331096196868
DNA (1344 bp, Edit)ATGACAGACAACCGCATCCGCTCGTCCCGCCGTCGCCTGCTGAAGGGCGCTGCGGCGGCAGGCGGTATCGGAGCGTTCGCTGGCTGTGCCCTGCTCGAAGAAGCCGGCGAAGAGGAACAACTGGACGGAATTCCGGATGAGCCGTTCCGAATCGTTCACTTTACTTTCGAATCCGGCCCGCCGGCTTTCTACGGCGACGAGATGATAAACGCCGTCGACATGATGGTCGACCGGATTAACGACCGTGGCGGGCTGCTGGGCGAACGCGAAATCGAAATCGTCGACCGCATCGACGAGGACGCCGGCGTTGAGTCGATGCGCGGTAGCGTTCGCCAGATCGCCCAGAACGACGAAGCCGACATGCTCATGGGCCTCATTTCGAGCGCCAACGCGCTTTCTGTGGTGCCGGCGGCGGAGGAAAACCAGATACCGTTCCTCGTTACTGTCCCCGGAACGTACCAGCTATTCGAGGAGAACCCTGACCTAGAGTATGCGGTCCGCACTGCCGGAACGAACGCGGCAGGTGCCATCGGTGGTGCCCGTATCGTCGAGCAGATGGACGATGTCGAGACGGTCGTCACCGTCGACCAGGACTACGCGTGGGGCCACGACCACCGCGACATGTTCGTCGAAGCGCTGGAGCGTATTCGGCCCGACATTGAGGTGCTGGAGACACGGACGCCGGAACCGTTCATCTCCGACTACAGCGCCCACATCAGCGCCGTACAGGACCTTGAGCCGGATGTCGTGTTCTCGAGCCTGTGGGGCGGCGACATCTCGACGTTTACCAGTCAGGCTGTCGACGACGGGCTCTTCGATGACATCGGAACCGGCGTCTTCGTCGGCGACACGGGCGCGCCGCTTCTCCGAGCGCTCGGTGACGACATGCCGGAAAACGTCATCATGGGCGGCCGTGGCGGCTACCAGCCCAACTACCGCTACGAGACTGCTGAAGACCATCAGGAGTTCGTCGACGACTACTTCGACCGCTACGGCGACATGCCCGGCTGGGGTGCCTACCACGACTGGGTCGCCTTCCAAGCACTGGAAGCGGGTGTCGAGCAGGCGGTTCAGCTGACCGGCAACTGGCCGACGGGCAGCCAGCTGATGTCGTCGATTCGAGGGCTGTCCTTCGAGACGACCCACGGCAGCCACGTGATGGCACAGGCCGGCGGCCGGCAGGCGTCCGCCCCCGGTGTCTTCGGTCAGCCCACGCCTGACCACGACTTCCCGGTCGACCACCACCTCCTCACCGACTACGAGTTCATCCCCGCACACGAGTGCAACCCGCCAGAAGGGATGGACACCTTCGAGTGGGTCGAACAGATCGAACCAGTCGAATAA
pI3.9093
MW (k)48973
Translation (446 aa, Edit)MTDNRIRSSRRRLLKGAAAAGGIGAFAGCALLEEAGEEEQLDGIPDEPFRIVHFTFESGPPAFYGDEMINAVDMMVDRINDRGGLLGEREIEIVDRIDEDAGVESMRGSVRQIAQNDEADMLMGLISSANALSVVPAAEENQIPFLVTVPGTYQLFEENPDLEYAVRTAGTNAAGAIGGARIVEQMDDVETVVTVDQDYAWGHDHRDMFVEALERIRPDIEVLETRTPEPFISDYSAHISAVQDLEPDVVFSSLWGGDISTFTSQAVDDGLFDDIGTGVFVGDTGAPLLRALGDDMPENVIMGGRGGYQPNYRYETAEDHQEFVDDYFDRYGDMPGWGAYHDWVAFQALEAGVEQAVQLTGNWPTGSQLMSSIRGLSFETTHGSHVMAQAGGRQASAPGVFGQPTPDHDFPVDHHLLTDYEFIPAHECNPPEGMDTFEWVEQIEPVE