Gene ID3380
Gene Name
Annotationhypothetical protein
Locationchromosome:1625594←1624677
Gene typeHypothetical gene
GC content0.639433551198257
Hydropathicity0.629836065573771
DNA (918 bp, Edit)ATGAGTACGTCCCGACATCCGGTCGCGCTCCGTCTTGAGCGACGCGTCGGTGAAGGCACCCGTTTACTAGGGACTGTCATGGCGCTGCCGTTACTCGACGGTATCTTCGCCGCCCTCGTCGTTGCGGGCGCTGTCTCCTCTGTCTTGGGGATGATTGAAGTCGGCCTGCTGATATTCGGCGGGAGTGCGACGCTCGCAGTCGTTCTCGCTGAGATGGAAGGCAGTCGCCGCGACCGAGTCCGAAACATCCTGCTTGTGGGCGCGCTTGTCGTCCCGTTTGCGGCCGTGCAGGCGGCTATCGCGCCGACTATCGAGTCGCTGTTGGCGATGGATATTTTCAAGCGCTTTGCAGCGCTTGTCATCCTCGCGGTTGCGGCGAAGACCGCCAGCGCGACCATCGGTGAATATCTTCCCGGGCCAGGAGTCATCATCGCCCTTGGATTGGTCGCCAGCTTCCAGCCCAACGGCTTTGCGGTTGCCGTCGTCGCCGAACCGATGTACGTGGTGTACGGGACCGGCGCAGCGCTTGTCGGTGTCGGGTTCGCGCTCGCTGTCGCGCTGTTGGGGCCGTGGCTGCGCGGTAACGTCGACATCGACCGGTTCCGGTTCGGCAGCGCCGTCGCACTAGGCGTACTGCCGCTTACGATCCTCGAAGTCGGCCCCATTACGGGTGAAGAGCCGCTTGCGCTCATCGTCTTGGCGCTGACGGGACTGCTCGCGTTCAACCCCGACGGGGCACTCGAGATAGGTCCACAGGAAACACCTGATACTGGTGTTCCTGCCGCAACTGACGGCAGTGGCGTCGATGACGAATCGCCGCTCGAGGACCCGCTGGACGAGCCATCCGGCAGCGACGATGACCAATCCGAGGACGGCGAACCGGGCGTTTCCGACGGCGACAGGGCCCCGTGGCTCTGA
pI3.9656
MW (k)31151
Translation (304 aa, Edit)MSTSRHPVALRLERRVGEGTRLLGTVMALPLLDGIFAALVVAGAVSSVLGMIEVGLLIFGGSATLAVVLAEMEGSRRDRVRNILLVGALVVPFAAVQAAIAPTIESLLAMDIFKRFAALVILAVAAKTASATIGEYLPGPGVIIALGLVASFQPNGFAVAVVAEPMYVVYGTGAALVGVGFALAVALLGPWLRGNVDIDRFRFGSAVALGVLPLTILEVGPITGEEPLALIVLALTGLLAFNPDGALEIGPQETPDTGVPAATDGSGVDDESPLEDPLDEPSGSDDDQSEDGEPGVSDGDRAPWL