Gene ID3350
Gene Name
Annotationhypothetical protein
Locationchromosome:1608105←1607446
Gene typeHypothetical gene
GC content0.7
Hydropathicity0.811415525114156
DNA (660 bp, Edit)GTGCACCGGGCGACTGTCCGACAGCTTTTCGGTGCCGGCGTCGTCGCGGCCATCGCGGCGGTGGCGGCAATTTCGACCTCGCCGCAGGCGCTTTTCGCGGCCGCCGAGCGGCTTGTCGAACGCCCCGGGCTGCTCGCCGTGACCGTCGTCGGTCTCTACCTCGTCCGACCGCTTTTGGCGTGGCCCATCAGCGCGCTGTCGATACTGCTTGGATATCTGCTTGGCGTGGCCGCGGCCCCGATCGCGCTTGCCGGTGCAGTCGTAACGACACTTCCCGCCTACGCGCTCGCGCGGCGGCTCGGCCACAGTGAGGGCGTCCTCGCCCGTGTCGGCGATGCTGGGGCCGTCGTTCGACGGACGACGGGTGATTTCCGGGGCATCGTCGCGGTGCGGCTTGCGCCGCTGCCGACAGACCCGGTCTCGTATGCTGCGGGGGTGGCTGGGGTCCCGCTACGACCGTACGTGCTGGGCACAGCGGTCGGAGAGGCCCCGTGGGTGCTAACGGCCGTGCTGCTCGGAGCGTCGACGAGCCAGCTTACAACCGCCGGCGCTGCTTCGAACCCGCTGTTGGTCGTGACGGCGCTGGCGTTGGCGGCACTGCTGGCCCTTTCGCGGCCCGCCTACCGTCGACTCGCCGATGACAGACCGCTCAGAACGTAA
pI11.637
MW (k)22245.3
Translation (218 aa, Edit)MHRATVRQLFGAGVVAAIAAVAAISTSPQALFAAAERLVERPGLLAVTVVGLYLVRPLLAWPISALSILLGYLLGVAAAPIALAGAVVTTLPAYALARRLGHSEGVLARVGDAGAVVRRTTGDFRGIVAVRLAPLPTDPVSYAAGVAGVPLRPYVLGTAVGEAPWVLTAVLLGASTSQLTTAGAASNPLLVVTALALAALLALSRPAYRRLADDRPLRT