Gene ID2646
Gene Namecdd
Annotationcytidine deaminase
Locationchromosome:1925680→1926096
Gene typeFunctional gene
GC content0.482014388489209
Hydropathicity-0.209420289855072
DNA (417 bp, Edit)ATGATGAGTAGTGATCACACATTGATTGCCCGTGCTCGTACAGCATTTGAATCAGCATATGTTCCGTACTCTGAATACCGTGTCGGGGCTGCAATTGAGACGACCGATGGGTCGGTGTACACAGGCTGTAATATTGAGAATGCAAACTATTCGAATAGTCTTCATGCCGAAGAAGTTGCTGTTGCCGCTGCAGTGAAAGATGGTCAGGACACATTCGAACGTATCGCAGTCGCGTCAGCTGCGAGGGATGGCGTTACACCCTGTGGCATGTGTCGACAAACACTCGCAGAGTTTGCTGATGGGTCACTTAAAGTTCTTTGTGATAAGGGTGCGGAGGGAGTTGAGACGTATACACTCACAGAACTACTTCCGAAAACAATCTCAGAGGAGACACTTCAGAATGCAGACGGACAGTAA
pI4.1679
MW (k)14695.2
Translation (137 aa, Edit)MMSSDHTLIARARTAFESAYVPYSEYRVGAAIETTDGSVYTGCNIENANYSNSLHAEEVAVAAAVKDGQDTFERIAVASAARDGVTPCGMCRQTLAEFADGSLKVLCDKGAEGVETYTLTELLPKTISEETLQNADGQ