Gene ID2639
Gene NamegrpE
AnnotationdnaJ/dnaK ATPase stimulator grpE
Locationchromosome:1917250→1918059
Gene typeFunctional gene
GC content0.446913580246914
Hydropathicity-1.25130111524163
DNA (810 bp, Edit)ATGAGTGATGAGTCAACTGAGAGCCACCAAACAGCCGAGCCGTCGCCGGATAGCGATATATCAGGTGATGAGGATGAGGATGAAAACGAACGTGAACATAACATGAACGAAGAAGAAAAGCATCAAACCAAGGATACGCATGGCTCATCTGAGAATCCTGATGAAAATAATCAAGATGCGACCACTGAAGCATCAAGTCTTGCGGATCAAGTCGCTAAATATGATGAAGCGCTTGCTGTGGAGGTCAAATCACTAACAAATGAATATGATGAACAACGTGAACGGATTGATGAACTTGAAGCAGCACTCAAGCGTTCGAAAGCAGACTTCGAGAATTATAAAAAACGAGCAAAAAAGCGCGAGCAGCAAATTCGCGAACGAGCCACGGAGGATTTTGTCGGACGAATCGTTGGCGTTCGCGATAATCTCGTGCGGGCACTTGAACAAGATTCAGACGCAGATATTCGCCCCGGAGTTGAGTCAACACTTGATGAATTTGATCGAGTGCTTGAAGATGAAAATGTAACATTAATTAACCCAGAGCGTGGGGACAATGTTGATCCAGCGCAGCATGAGGTTCTCATGCGTGTCGATGCCGACTTACCTGAGGGAACAGTTGCTGAAGTGTTTCAACAGGGATATCAGATGGCTGGGACAGTCATTCAAGAAGCACAAATAACAGTCAGCACAGGCGCGGACATAACCGAAAATAAAAATGAAAATGAAAATGAAAATCCGGATGCAAATGCAAACACCGATACTGACGCTATGAAAGAAGAAACAAACAGCCTCGAAAACGAATCAGAGTGA
pI3.9071
MW (k)30263
Translation (268 aa, Edit)MSDESTESHQTAEPSPDSDISGDEDEDENEREHNMNEEEKHQTKDTHGSSENPDENNQDATTEASSLADQVAKYDEALAVEVKSLTNEYDEQRERIDELEAALKRSKADFENYKKRAKKREQQIRERATEDFVGRIVGVRDNLVRALEQDSDADIRPGVESTLDEFDRVLEDENVTLINPERGDNVDPAQHEVLMRVDADLPEGTVAEVFQQGYQMAGTVIQEAQITVSTGADITENKNENENENPDANANTDTDAMKEETNSLENESE