Gene ID2638
Gene Name
Annotationhypothetical protein
Locationchromosome:1916403→1917149
Gene typeHypothetical gene
GC content0.476572958500669
Hydropathicity-0.0600806451612902
DNA (747 bp, Edit)ATGGCACAACTTGAGATACTAACAAATGCAACAGACATATCATTGATAGATCCATCATTGATCGAAGGATTTCCTGGCATTGGGCTTGTCGGGAAAATTGCGGCTGATCATCTCGTTGCAGAGTTTGAAATGACGCACTACGCGGACGTTCATTGTGAAACAATCCCTGCAGTAGCAGTGTATCAGGAAGACGACCCTGCGCTTCGATCACCTGTTCGGTTGTACGTTGATGTTGATCGCGATCTTGCCGTGCTTCAAAGTGATGTCCCAATCAGCCCCGAGGCAGCAACGGAAGTCGCAACATGCCTGTCTGAATTTATTGATGAAACAGCCATGACACCAATATATCTTTCCGGCATTCCCAAAGAAAAAACTGAAACAGTTCCATCGTTGTATGGTTTTGGTGTTAGTGAAGGGGTGAATCAAGTTCAAAAAGCAGATATTGCGTTACCAGATGAAACAGGACTGATCTCAGGTCCAACCGGAGCACTGTTGAGCGATGCTGTGATGTCAGATCGAGATGCCATTGGCTTAGTCGTTGAGTCGGACCCACAGTTCCCTGATCCAGAGGCGGCACGGGTGCTCATTAATCGCGGGATTGAACCGCTCACTAGTATTGACGTGCCCGTTAATGATCTCGTTGATCGAACCGAACAAATCCGGGAAGCTAAAGAGCGCCTTGCGAAGCAAATGCAAGAGGGGGGTGAAGAGAGTACACAAGCTCGTCCGATTGGAATGTATCAGTAA
pI3.8971
MW (k)26731.1
Translation (247 aa, Edit)MAQLEILTNATDISLIDPSLIEGFPGIGLVGKIAADHLVAEFEMTHYADVHCETIPAVAVYQEDDPALRSPVRLYVDVDRDLAVLQSDVPISPEAATEVATCLSEFIDETAMTPIYLSGIPKEKTETVPSLYGFGVSEGVNQVQKADIALPDETGLISGPTGALLSDAVMSDRDAIGLVVESDPQFPDPEAARVLINRGIEPLTSIDVPVNDLVDRTEQIREAKERLAKQMQEGGEESTQARPIGMYQ