Gene ID1282
Gene NameHuta_1282
AnnotationPhosphoribosylanthranilate isomerase
Locationchromosome:1252056→1252694
Gene typeFunctional gene
GC content0.69
Hydropathicity-0.0481132075471698
DNA (639 bp, Edit)ATGACGCGCGTGAAGGTCTGTGGGCACACCCGCGAGGCGGACGTGCGGGCGAGCGTCGCCGCCGGCGCGGACGCCGTCGGCGTGATCAGCGGCGTTCCAGTCGAAACGCCCCGGGAAGTCGCCCCTGAGCGCGCCGCCGACCTGCTCGACGCCGTGCCGCCGCTCGTCTCAGGTGTCCTCGTGACGATGCCCGAGACAGTCGAGGAGGCCCGGGAACTCGTCGCGGAAACCCAGCCGGACGCCGTCCAGGTACACGGAACGCTCGATCCCGAGGAAGTCGAAGCACTCACAGCGGAAATTTCCCAGCCGATCCTGGTCGCACTCGACCACGACGCCGAACTAGACGCCTACGCCGACGCGGCCGACGGACTCGTCGTGGACTCGCTGGACGAAGCCGGCGGCGGCGGGACTGGTCAAACCCACGACTGGGACCGAACGGCAGAAATCGTCGAACGCCTCGACGTCCCGATCCTGCTGGCCGGCGGACTCACGCCCGAGAACGTCGCTGAGGCCGTCGAGACCGTCCGGCCCTTCGGTGTCGATACCGCCAGCGGTGTCGAGCGCGACGGTGGGGTCAAGGATCACGACGCCGTCGAACAGTTCGTCGATCGGGCTGGGGAACCGCGGGTGGTGGCATGA
pI3.8969
MW (k)22049.4
Translation (211 aa, Edit)MTRVKVCGHTREADVRASVAAGADAVGVISGVPVETPREVAPERAADLLDAVPPLVSGVLVTMPETVEEARELVAETQPDAVQVHGTLDPEEVEALTAEISQPILVALDHDAELDAYADAADGLVVDSLDEAGGGGTGQTHDWDRTAEIVERLDVPILLAGGLTPENVAEAVETVRPFGVDTASGVERDGGVKDHDAVEQFVDRAGEPRVVA