Gene ID2494
Gene Name
Annotationprotein N-acetyltransferase-like protein
Locationchromosome:1209955→1210854
Gene typeFunctional gene
GC content0.69
Hydropathicity-0.28561872909699
DNA (900 bp, Edit)ATGGCCGATATTGCTGTCCGACCGGCCCAAGCCGACGACTACGAAGCCGTCGCCGCGTTCACTGCCGACACGTGGCAGCGGCTGGACGGCGACTACATCCCCGACGTCTTCGACGAGTGGGTCGCATCCGACGGTCCCACCCAGCGGACGCTCGTAGCGACCGTCGAGGACCGTCCGGTCGGGCTTTGTCAGGGCGTGTTGCTCTCCGAAGACGAGGCGTGGGCACAGGGGATGCGCGTCGACCCGGAGTACCGCGGCCGCGACATCGCCCGCCGACTCGTTACGGGGGTCTTCGAGTGGGCAGCAGACGCCGGCGCGACCGTCTGCCGAAACATGGTGTTTTCGTGGAACGAGGCGGGCCTTGGGCTCTCCCGGTCTGTCGGCTTCGAGCCGCTGGCGTCGTTCCGCTGGCTGGAGCCGACACCGGATGCCGACGCCGACTGCGGGCTGGCTGTCGACAGTACCCCCGACGCAGCGTGGCGCGGCTACCGCCGTAGCGACGCCTGCCGACGCCTGTACGGGCTCGGACTCGACACCGACGAACCGTGGGCGCTGGCGGAGCTGACACGCGAGCGGCTGGCGGCCGTCGAACGCCCGCTCGTCGTCGCCGATGACGACCACATTAGAGGTGTCTCCTACCGAGTGCGAACGACCGACGAAGAAACCGATGACGGCGAATCGGTCAGCCGCGCCGAATACGGCGTCGGCGCGTGGAACGACGCCGAGGCGCTTTCGGCGCTTTCGGCCGCTGTCGCTCGTGATGCAGCTGCCGCAGGCGCAGACCGAACGCGGCTGCTGGTCCCCGAGACGCCGCGGCATATCTCCGATGCGGCCGCCGTCGGCGTTGCAGCCGCTGATGCGCCCGACTTCGTGCTCGAACGGGAACTAACCCGGTACTGA
pI4.1121
MW (k)32539.9
Translation (298 aa, Edit)MADIAVRPAQADDYEAVAAFTADTWQRLDGDYIPDVFDEWVASDGPTQRTLVATVEDRPVGLCQGVLLSEDEAWAQGMRVDPEYRGRDIARRLVTGVFEWAADAGATVCRNMVFSWNEAGLGLSRSVGFEPLASFRWLEPTPDADADCGLAVDSTPDAAWRGYRRSDACRRLYGLGLDTDEPWALAELTRERLAAVERPLVVADDDHIRGVSYRVRTTDEETDDGESVSRAEYGVGAWNDAEALSALSAAVARDAAAAGADRTRLLVPETPRHISDAAAVGVAAADAPDFVLERELTRY