Gene ID2468
Gene Name
Annotationhypothetical protein
Locationchromosome:1199854←1197089
Gene typeHypothetical gene
GC content0.607013738250181
Hydropathicity-0.368838219326818
DNA (2766 bp, Edit)ATGTCATCGCTTGGTCCCTCCGGATTGCGTCGGCTGGCGCTCGTTGCGATAGTGGTGGGTTTCGTCGTTGCTGTTGGTGCCGGCACAGCGGCGGCCGAGCCCGAAATCGAGGACTTCGAATTCGATACCGACGACGAGCTCGCCGGCGCGATAGCTGAGTACGAGGTCGGAGGAGATGTCGCGAACGTCTCTGAGAACCAAAATCTCGTCTTCGAGCTCGACGTTACGGAGTGGACAGAGAGTGAAAACGGCGAGTTCATCGATATCGTCGACACCGGTGACTTCGACGACGCCGATGCATCTGGTGGTGTTATTACCTTCACGAAGACGGCCGGCGGTGAGGACGTCTCAGCCGTAGCTACCATCTCGCTTCGAAACCCGACTATTGACGAGGCAACCGCAACGCTGACCGTTCACAGCGGGGAGGGGACCAGCGAGCCGGCAACTGAAACCGTCGAGTTCGGTGAGATAGCTGCGTCGTTCGCCGACGACCCGGTCGACAGTATCGGACCGGATGACGAAACAACACTGTCGGTCGAAGCTGACGGGAGTCCCGCAGAACACGTCGTGGTATCCTCGCCGGGGTTGGACGGCAACCAACTGGAGTCGATTTTCAGTGTCGATAGGGACCACGAAGATATCGGCGTCGAGACCGACGGCGACCGCCTGCTCATCAATCGGCCAGCTGATGCCGGCGAACAGCCACCTGTGCCGGAAATCGAGGCCTCGTTCACTCACGTCGGCGCTGCTAACTATCAGTTCGTTATCAGCGTCGACCGTTCTCGTGAAGAGACAGTCATCCCGCTCGAAGTCGAGGAGCCGGAGATCGATGTCGAATTCGACGAAGACCTCTACGAGGTGCCGGCTGGTGACCTCGTGACGATGGACGTTAGCCTCGATGGCCTCGACGAGACGTACTTGCTTGTCGGCGCTGACGGAACGACCGCCGAGGAAGGCGTCAACGATTTCCTCGATATCGTCAAATTCGACGGTGGTGAGCTGACAGTCAACACACGGTTGCTCGGAACTGATGCACCCGCGGACGCCGTCTACATCACTGACGGGACGGTTCACAGTTATCTCCACGGTGATGAAACCGAGTTCGACGATGTGGATTTCAGGGAAGACGAGGAAGGGGAGGGTGACGAGATAGCAGCGTCGCTTGACGAATACCGGGCCGAACTCGATATGACCGAACAGCCCCGTCCGCTTCAGCCGGACCGCTATCGAATCGTCGCGGGAGCGGAAGGAACAGTCATCACGCGTGACGACGAGATACCCGACTTCGACTATCCGCTAGGGCGGTCGAACCTGCTGTTGAATCAGCCGGAGCCGGGAGAGGTAACGACCCACGTCGCCCCGCAAGCGAGCGCAAACAGCGTCGAAGAGACCGGCAGCCTCAACGAGCTACTTGACGAACTTACCGAACGGGAGACGGTCGCGAAGGGCGACCGACTCGTCTTCGAAATCGAGGCGACGGGCATCTATGGCAACCTGTTTGCCTTCGGTGATGGCTCCGAACCGCCGTTTGAGGAGGGTGTTCATCCCCGAGCGCTTGGCAGCGTCGTTGACGCCCACGAGGGCATTATCGTCAACGTCAGCGAAACCAACTCGGACCCCAACACGGCTCCAACTGAGATTGATTTCAATGAACCAGCGGACGGCGATGCCTATGTCCTGCCAGCCCACGAAGACGAGGAACTGAGCGAAATCGACCGGTTCTACGTTGTCCTCGATACTCGCGACTCGGGTCCGTTTACCCGCTCGGTCCGCCACGGCGACGAGTTCGATGTCGAGTTCGGCTACGAATCACCGTCAGACGCCCGACACCGGTTCGTTGACGTGCCGCTCGGCGTCCGGCCACCGGCATACAGCATCGACCCCGACCTCGTCGACGAGAACCCGAACACCGAACACTACCCCTACTACCGGACAAGCGAGACCGGCGAGACCGACATCGCGCCGTTCCGCATCGAAGACCCCAGTGCCGAGTACGACCGTACGACCGTCGCCGATGAGCTGCTGGTCCACAACGGAACCGAAGTAACCATAGAGGGAACGACAAACGTCGCACCGGGGACGGAGACCCACATCCAACTCATCGCTCACAACCGGACGAATCCGACCCGCATCACCATCGACGAAGTCGAGATAGACGAAGACGGCAGCTTCAGCGCCACGGAAGACCTCTCGACACTCCGGGTCGGAGAAGATGTCGAAGCGGAGTTCTACGCCAACCAGCGGCTCGCTGACAAGCGCGCTGCGGATGTCGTCGACGACCTCGACGACCCGAGCGAGTTCATCGTCACCGATGTCGGCAATCCGGTGACAATGACCGAGGGCGACAACGACACGCGTGTGTCGGCAACGATAGAAAACACCGGCAACGCGGCTGACAGAAAGCCCATCGAGTTCGTCTTTGAGGACGCTCAGATAGCAGAGACCAACAGAACCGTCGAGCCCGACGAGCCGGCACCGTTCAACTTCGATGTGCCTGACGGACTCGAAGCCGGGACCTACAACTACACTGTTGTGACACCCGACGACGAGGCGTCCGGACAGGTCGTTGTCGAGCCACCGGAGCCCGAAGAGGTCATCGCTGCGGGCGGTGATGACCCCGTTGACGACCCGGCAGAGCCGGTCGATGATAACCTGCCGGCCGACGCCCTCGGCGAACTCGTCGGGGCGCTGACGAGCCTAGTCGGGGCCAGACACGCAGTCGGCGCGGCGGTCATCGTCGGTGGGGCGTACGTACTCGGCGGTTAG
pI3.5843
MW (k)98819.4
Translation (920 aa, Edit)MSSLGPSGLRRLALVAIVVGFVVAVGAGTAAAEPEIEDFEFDTDDELAGAIAEYEVGGDVANVSENQNLVFELDVTEWTESENGEFIDIVDTGDFDDADASGGVITFTKTAGGEDVSAVATISLRNPTIDEATATLTVHSGEGTSEPATETVEFGEIAASFADDPVDSIGPDDETTLSVEADGSPAEHVVVSSPGLDGNQLESIFSVDRDHEDIGVETDGDRLLINRPADAGEQPPVPEIEASFTHVGAANYQFVISVDRSREETVIPLEVEEPEIDVEFDEDLYEVPAGDLVTMDVSLDGLDETYLLVGADGTTAEEGVNDFLDIVKFDGGELTVNTRLLGTDAPADAVYITDGTVHSYLHGDETEFDDVDFREDEEGEGDEIAASLDEYRAELDMTEQPRPLQPDRYRIVAGAEGTVITRDDEIPDFDYPLGRSNLLLNQPEPGEVTTHVAPQASANSVEETGSLNELLDELTERETVAKGDRLVFEIEATGIYGNLFAFGDGSEPPFEEGVHPRALGSVVDAHEGIIVNVSETNSDPNTAPTEIDFNEPADGDAYVLPAHEDEELSEIDRFYVVLDTRDSGPFTRSVRHGDEFDVEFGYESPSDARHRFVDVPLGVRPPAYSIDPDLVDENPNTEHYPYYRTSETGETDIAPFRIEDPSAEYDRTTVADELLVHNGTEVTIEGTTNVAPGTETHIQLIAHNRTNPTRITIDEVEIDEDGSFSATEDLSTLRVGEDVEAEFYANQRLADKRAADVVDDLDDPSEFIVTDVGNPVTMTEGDNDTRVSATIENTGNAADRKPIEFVFEDAQIAETNRTVEPDEPAPFNFDVPDGLEAGTYNYTVVTPDDEASGQVVVEPPEPEEVIAAGGDDPVDDPAEPVDDNLPADALGELVGALTSLVGARHAVGAAVIVGGAYVLGG