Gene ID2456
Gene NamecoxA_1
Annotationcytochrome-c-like terminal oxidase, subunit I 1
Locationchromosome:1189595→1191358
Gene typeFunctional gene
GC content0.603174603174603
Hydropathicity0.605792163543444
DNA (1764 bp, Edit)ATGGCTGCAGAACAGCTCGCGTTGGCAGTTCTCATGGGGGCGCTCGTGCTTGCGGCGTTTGGGTTCGTCGCCCGCGTGCAGAACTGGCATCTCCCGTTCGTTGGTGGCCAGCGGGTCGCCACCGACGGCGGTCACGCGCACAAACCCGCTGGTATCACCCGCTGGCTAACGACTGTCGACCACAAGGATATCGGCATCCTGTACGGCATCTACGGTGTCATTGCCTTCCTCTGGGGCGGCGTCGCCGTCATGTTCATGCGCTTCGAGCTCTGGACGCCCGGAGCAACACACATGAGCACCGAGATGTACAACGCTTTGCTGACGAGCCACGGCATCACGATGCTGTTCCTCTTCGGGACGCCGATCATCGCGGCCTTCGCGAACTACTTTGTCCCGCTGCTCATCGGTGCCGACGACATGGCGTTCCCGCGCATCAACGCCATCGCGTTCTGGCTGCTCCCGCCGGGGGCCATCCTCATCTGGGCTGGCTTCTTCACGATGCCGCTGGACATCGGTGTCGGACCGGCCGAGACCTCGTGGACGATGTACACGCCGCTTTCGGTTGAGCAGTCCAACGCCGGTGTCGACCTCATGCTCCTTGGGCTTCACTTAACCGGCGTTTCGGCGACGATGGGCGCTATCAACTTTATCGCGACCATCTTCACCGAACGCTCCGACGACGTGACCTGGGCGAACCTCGACATCTTTAGCTGGACCATTCTCACACAGTCCGGCATCATCCTGTTTGCCTTCCCACTGCTTGGCAGCGCCCTCCTCATGCTGCTGCTCGACCGGAACTTCGGAACGCTGTTTTTCGCCACCGAAGGCGGCGGACCCATACTGTGGCAGCACCTCTTTTGGTTCTTCGGTCACCCCGAAGTCTACATCCTCGTGCTGCCGATGATGGGTCTCGTCTCGTGGATTCTGCCGAAGTTCGCGGGCCGAAAGCTATTCGGGTTCAAATTTGTCGTCTATTCGACGTTAGCAATCGGTGTGCTCTCCTTCGGTGTGTGGGCACACCACATGTTCGGGAGCGGCATTGACCCACGCATCCGTGCGTCGTTCATGGCGACATCGCTGGCGATTGCGATACCGTCCGCGGTCAAGACGTTCAACTGGATTACGACGCTCTGGAACGGCAACATCCGACTGACAGCACCGATGCTGTTCTGTCTCGGCTTCGTTGCCAACTTCGTCATCGGTGGCATCACCGGCGTTTTCCTCGCGTCGGTGCCGGTGAACCTCCTGCTCCACGAGACCTACTACGTCGTTGGTCACTTCCACTACATCGTGATGGGGATGATTGCCTTCGCCGGCTTCGGTGCCATCTACTACTGGTTCCCCATCGTTACCGGCCGTATGTACAACCGCCGGCTCGCGAAAGCGCACTTCTGGCTGTCGATGATCGGCTCGAACATCACGTTCTTCGCGATGCTGATCGCTGGCTACCTCGAAATGCCGCGGCGGTATGCGACCTACGAGTTCGACCCGAACCTTGCGCCGCTGACTGAAGTTACACTGCTGCATCAGGCGATGACAGTCGGCGCTGTCATCATCGCTGTCGGGACGTTGCTGTGGTTCGTCAACGTCGTCTGGTCGTGGAAGAAGGGCACGGAAGTCACCGACCCCGACCCGTGGAACACCAAAGAATACGGACTCCACGGCCGCGAGTTCGCGTGGTTCGAACAGCAGCTCGCTGCCACTGATGGCGGCGACGAGGAGCTTGCGACGGACGGCGGCGAACCAGCCGACGAAGCACAGTAA
pI6.1529
MW (k)64791.9
Translation (586 aa, Edit)MAAEQLALAVLMGALVLAAFGFVARVQNWHLPFVGGQRVATDGGHAHKPAGITRWLTTVDHKDIGILYGIYGVIAFLWGGVAVMFMRFELWTPGATHMSTEMYNALLTSHGITMLFLFGTPIIAAFANYFVPLLIGADDMAFPRINAIAFWLLPPGAILIWAGFFTMPLDIGVGPAETSWTMYTPLSVEQSNAGVDLMLLGLHLTGVSATMGAINFIATIFTERSDDVTWANLDIFSWTILTQSGIILFAFPLLGSALLMLLLDRNFGTLFFATEGGGPILWQHLFWFFGHPEVYILVLPMMGLVSWILPKFAGRKLFGFKFVVYSTLAIGVLSFGVWAHHMFGSGIDPRIRASFMATSLAIAIPSAVKTFNWITTLWNGNIRLTAPMLFCLGFVANFVIGGITGVFLASVPVNLLLHETYYVVGHFHYIVMGMIAFAGFGAIYYWFPIVTGRMYNRRLAKAHFWLSMIGSNITFFAMLIAGYLEMPRRYATYEFDPNLAPLTEVTLLHQAMTVGAVIIAVGTLLWFVNVVWSWKKGTEVTDPDPWNTKEYGLHGREFAWFEQQLAATDGGDEELATDGGEPADEAQ