Gene ID2432
Gene Name
Annotationasparaginase
Locationchromosome:1179435→1180319
Gene typeFunctional gene
GC content0.698305084745763
Hydropathicity-0.213265306122449
DNA (885 bp, Edit)ATGCGAACGATTGTCCATGGCGGTGCGGGAACAGCTCCGGCGGAGCCGAACGAACGGCTCGCGGTGCTGGAGGGAGCCGCCGATGCCGGAGCCGACGCACAGACGCCGACCGAGGCGGTCTGTGCGGCCATCCGCCGGCTGGAGTCGGCCCCCCGATTCAACGCCGGTGTCGGCAGCGCCGTTCAATCCGATGGATACATCCGGACTGACGCGGGGCTGATGACGGACGACAGGTCTGTTGGTGCTGCTGCGGGGATGCCCGGTGTCGAACACGCTATCGATGTCGCCCGGACAGTCAAAGACGAGACGCCGCACGTTCTCGTGGCTGGCGTCCACGCCGTCGACCTCGCGGAGACCGTCGGCGTCGAGACCACCGTCGACCTCTGGACCGACCGGACGCGACAGCGGTGGGACGACCTCGATACGAAGCCACCGGACGAGTTGGGCGACCAACTCGCGTGGGTCACCGACCGGTTCGGCGGCGACCCCGCCGGCCGCGACGGAACGGACCACGACACCGTCGGAGCGGTCGCAACCGACGGCGACCGCATCGCTGCCGGCACCTCGACGGGCGGCCGCTGGCTGGCGCTTGCCGGCCGCGTCGGCGATGTCCCGCAGGTCGGCTCCGGCTTCTACTGTACGCCAGCCGGTGGAGTCTCTGCCACCGGTGCCGGCGAGGATATCGCGCGACAAACGCTTGCCCGCTCGGCAGCCGACCGCCTCGATGCTGGCGACGATGCACAGCGGGCGGTCGAGGCAGCCATCGACGACTTCGACGAGGCTGTCGAGGGAACTGCTGGTCTCATCGCGCTGACGCCCGACGGCGACGCCGGAGCGGCATACAGCAGCGAGGCGATGCAGACCGCGGTTTCCGGAACGCTCTGA
pI4.0595
MW (k)29864.6
Translation (293 aa, Edit)MRTIVHGGAGTAPAEPNERLAVLEGAADAGADAQTPTEAVCAAIRRLESAPRFNAGVGSAVQSDGYIRTDAGLMTDDRSVGAAAGMPGVEHAIDVARTVKDETPHVLVAGVHAVDLAETVGVETTVDLWTDRTRQRWDDLDTKPPDELGDQLAWVTDRFGGDPAGRDGTDHDTVGAVATDGDRIAAGTSTGGRWLALAGRVGDVPQVGSGFYCTPAGGVSATGAGEDIARQTLARSAADRLDAGDDAQRAVEAAIDDFDEAVEGTAGLIALTPDGDAGAAYSSEAMQTAVSGTL