Gene ID2416
Gene NamenadB
AnnotationL-aspartate oxidase, quinolinate synthetase subunit B
Locationchromosome:1172067←1170562
Gene typeFunctional gene
GC content0.694555112881806
Hydropathicity-0.166067864271457
DNA (1506 bp, Edit)ATGACAGGGGAGCCACGCGAGACCGAGCTACTCGTCGTCGGCAGCGGTATCGCCGGCTGTGCGGCGGCGCTTGCCGGTGCCCGCGCCGGCGCGTCGGTGACACTGGCAACGAAGGCCACCCGCCCCGAGGAGTCGACATCCTACTGGGCACAGGGCGGCATCGCCGTCTCCCGCGGCGACGCCGAGCAGTTCAAACGCGACATCATCGCCGCCAGTGACGGACTCGCTGACGAGACTGCTGTCGATGTGCTCGTCGAGTCGGCCGACGAGGCTGTCGAGGACGTACTCGTCGAGACGCTCGGCGTCGACTTCGACGGCGACGACGGACACGAGTACGCCCGCGAAGCAGCCCACAGCGAGCCGCGTATTCTCCACGTCGACGCCGCAACCGGCAAGCACCTGCTCGGGCCGTTCATGTCGCATCTCGAATCCCACGACGACGTCGAGATACTGGCCGACACCGCGGCGCTCGAACTCGTCACCGCGGAAGGCCGAGTCCACGGCGCGATGCTGGAGCAAAACGGCGAGTGGGCACCCTGTCTCGCCGGCGCGACGGTGCTGGCGACCGGCGGCGTCGGGGCCTGCTACGGCCGGACGACGAACCCACCGACGGCGGCCGGCGACGGCGTTGCGATGGCGGCGCTGGCCGGCGCTGACACCGCCGACATGGAGTACGTCCAGTTCCACCCGACCGCCTTTGCCGGCGAGGACGGCGACGACCGCGGAACGTTCCTGCTCAGCGAGGCCGTCCGTGGAGAGGGCGCGCTGCTGCGGAACGCCGACGGCGAACGGTTCATGCCGGACTATCACGAGGACGCCGAACTCGCGCCGCGGGATGTCGTCGCCCGCGCGGTCAGGGCGGAACGGGAACGGACCGGTGGGGTGTCTCTCGATGTCGGTCCGGTCGACTTCGAAGCCGAGTTCCCCGGTCTGGCGTCCGCATGCCGGGACCGCGGCGTCGATATCGAGGCCGGCATCCCGGTCGCACCGGCGGAACACTTCCTCTGTGGCGGCGTTGCTGTCGACACCGAGGGCCGGACCTCACTAGACCAGCTGTATGCGGTCGGCGAGTGTGCCCGAACCGGCGTTCACGGCGCGAACCGGCTGGCCTCGACGAGTCTGCTTGAAGGGCTCGTCTGGGGGCTCAGAGCGGGCGAGGCGGCAGCCGGCAACGAACCGGTGGCCGTCGAAGTGCCGGAGCTTCGGGACAGCGACCCGTCTCTTCCCGACAGCTTCGCCGAAGAGAAGTTCATCCGGCTGCGGCGCGTCATGGACGACTACGTGGGCATCGAGCGGACGCCTTCGGACCTCGACCGGGCGGCGGGTGTCCTCCGCCGGCTCAAGGGCGAAATCGACGCCTACATCCGAACCCGGACGAGTCGGTCGCTGTACGAACTCCGGAACGCGTGTATCGCCGCGCTGCTGATTACCCGCGCGGCCCGGGAAAACGAGACCTCGCGCGGGTGTCATCACCTCGTCGAGGAGGCTGCCGCGGATGCGGATTGA
pI4.2516
MW (k)52700.4
Translation (500 aa, Edit)MTGEPRETELLVVGSGIAGCAAALAGARAGASVTLATKATRPEESTSYWAQGGIAVSRGDAEQFKRDIIAASDGLADETAVDVLVESADEAVEDVLVETLGVDFDGDDGHEYAREAAHSEPRILHVDAATGKHLLGPFMSHLESHDDVEILADTAALELVTAEGRVHGAMLEQNGEWAPCLAGATVLATGGVGACYGRTTNPPTAAGDGVAMAALAGADTADMEYVQFHPTAFAGEDGDDRGTFLLSEAVRGEGALLRNADGERFMPDYHEDAELAPRDVVARAVRAERERTGGVSLDVGPVDFEAEFPGLASACRDRGVDIEAGIPVAPAEHFLCGGVAVDTEGRTSLDQLYAVGECARTGVHGANRLASTSLLEGLVWGLRAGEAAAGNEPVAVEVPELRDSDPSLPDSFAEEKFIRLRRVMDDYVGIERTPSDLDRAAGVLRRLKGEIDAYIRTRTSRSLYELRNACIAALLITRAARENETSRGCHHLVEEAAADAD