Gene ID2356
Gene NamemutH
AnnotationDNA mismatch repair protein
Locationchromosome:1141994→1142851
Gene typeFunctional gene
GC content0.531468531468531
Hydropathicity-0.572631578947369
DNA (858 bp, Edit)ATGTTTGATTTACCGTCCGGGCCTGACGCCGAGCAGGAAGACATTCTTCGTGCCACGAACGCACTACTGGGTCGCTCATTCGGAGAGATAGACGAAGAAATACAGGGGATGGCAGACGACGAACGTGCCCGGTCAAAGCACGGCGTAGCAAATGTCATCGAGAGTGGGTATTTTAATATAGAGACAAACTCCTCCGCAGAACCGGACTTTGGCAAAGCTGGTATCGAACTCAAGGTTACACCGTTACGACTGACAGGGAATAATGAGCTGGTCCGGCCGAAAGAGCGGCTTGTGCTCTGTATGTGCGATTACATGGAAGTCGTTGATGCCGACCACTGGACCGATGTTCCTGCACTTCGGAAAAAGCTTGAGCAGGTACTGATAATCTGGTATATACATATTGTTGGCCAGGACCGACGTACCTACCCCATTGTGTGGTGGACACTTTGGGAACCGATGACCGAACCTGAGTGGTCCGAGATTATCCAGTCTGACTTCGAAATCTGCAAGAAGCGCATTTTGAACGGTGAGGTACCGAGCGAAAAACACACTCAGCTCCTCGGAACTTGCCCGAAGCATGGCGGAGGGTACGACCGCGAAAACCCAGAAGAATCTCCGCGGTCTTCCCGAGTTGCCCAAGACGCACATCCAACGCTCGATTATGCTGAGAAACGTGGCTGGTCAATCGGACTCGGGGGCTGCATGGACCTCTTTGAGTCCGCAACTGGCCTTGAAAAGGCAAGTCGTGGGCGCGCCAGCGGCATCGAATTAACTGCGCTTTGGGGAGCGGCCCAAGAGCGTACGCCGCACGATATCCCAAGGTTTAGCGATGCAATAAATGAAGACGATGACAGCTAG
pI4.4568
MW (k)32054.8
Translation (284 aa, Edit)MFDLPSGPDAEQEDILRATNALLGRSFGEIDEEIQGMADDERARSKHGVANVIESGYFNIETNSSAEPDFGKAGIELKVTPLRLTGNNELVRPKERLVLCMCDYMEVVDADHWTDVPALRKKLEQVLIIWYIHIVGQDRRTYPIVWWTLWEPMTEPEWSEIIQSDFEICKKRILNGEVPSEKHTQLLGTCPKHGGGYDRENPEESPRSSRVAQDAHPTLDYAEKRGWSIGLGGCMDLFESATGLEKASRGRASGIELTALWGAAQERTPHDIPRFSDAINEDDDS