Gene ID1143
Gene NameHmuk_1143
Annotationprotein of unknown function DUF583
Locationchromosome:1089208←1088138
Gene typeFunctional gene
GC content0.7
Hydropathicity0.540168539325843
DNA (1071 bp, Edit)ATGCGACGCACGCTCTGCGCACTGCTCGTAGTGATCCTCGTGGTCGGAGCGCTCCCCGGGACGGCGGCCGCAGCCAGCCGGACCGGCGGGACAGTCACGGTCGGCCCGGGCGAGACGATCGACGACGACCTCGAAGCGGTCGGCGGCACGGTCGTCGTCGAAGGGACCGTCACGGGAGACCTCGAAGCCACCGGCGGCACCGTTATCATCGACGGCACGGTCGAGGGCGACGTCGAAGCGGCTGCCGGCACTCTCGACATCGGCGGAACCGTCGGCGGCGACGTCGAGGGGGCTGGTGGTTCCGTGACGGTCGACGAGGGCGCTCGGATCGGCGGCAACCTGACCGCCGGAGCCGGCTCGGCCACCGTCGACGGACGGATCGACGGCAACGTCGAGATCGGTGCCGAAGAGATCACGCTCGGGCCGACCGCCGACATCCGCGGCGATCTGACCTACGACGGCAACCTGAACCGCGCGGACGGCGCGACCGTCGGCGGAACAGTCGAGCGGACCGACAACGTGACCGTCAGCCCCAGTGGCCCGTCGTTCGCGTTGCCGACCGGGACCTTCACCGCCTACGGCGTCCTCGCGAACCTCGTCGCGGGGGCCGTCCTCGTGGTGGCGTTTCCCCGCTTCTCGACGAGCGTCGCCGACGACGTGACCGACGATCCCCTGCGGATGGGGGCGTTCGGACTGCTCGCGCTCGTCGGCGGTCCAATGGTCTGTGTGCTGCTGTTCGTGACGCTGGTCGGCATCCCGCTGTCGATCGCCGGCATGGTCGCGTACGTCTTCCTCGTGTGGGCGGGCGCACTGTACGGCCGGTTCGCCCTCGGCCGCTGGCTCCTCCAACGGATCGGTCGAGACAGCCGGTGGCTCGCGCTACTGGTCGGCGTTCTCGGGGTCGCTGCGGTGAAGTTCGTACCGATCCTCGGCGATTTCGTCGAAGCTGTCGTCGTGCTGGTCGGGCTCGGCGCGCTCGTCCTCGGCATGTACGATCGCTACCAGAGCGACGAGGACGATCCCGGCCCCACCCCCGAGCCGGCCGCTGGCGACGCCGAGCCGTCGGCTTGA
pI3.8038
MW (k)35570.4
Translation (355 aa, Edit)MRRTLCALLVVILVVGALPGTAAAASRTGGTVTVGPGETIDDDLEAVGGTVVVEGTVTGDLEATGGTVIIDGTVEGDVEAAAGTLDIGGTVGGDVEGAGGSVTVDEGARIGGNLTAGAGSATVDGRIDGNVEIGAEEITLGPTADIRGDLTYDGNLNRADGATVGGTVERTDNVTVSPSGPSFALPTGTFTAYGVLANLVAGAVLVVAFPRFSTSVADDVTDDPLRMGAFGLLALVGGPMVCVLLFVTLVGIPLSIAGMVAYVFLVWAGALYGRFALGRWLLQRIGRDSRWLALLVGVLGVAAVKFVPILGDFVEAVVVLVGLGALVLGMYDRYQSDEDDPGPTPEPAAGDAEPSA