Gene ID2114
Gene Name
Annotationhypothetical protein
Locationchromosome:1025108→1025752
Gene typeHypothetical gene
GC content0.714728682170543
Hydropathicity0.125233644859813
DNA (645 bp, Edit)ATGGACCGCCAGCACGTCGCCGTTCTCGTGGCTGTCTGCATGGCGCTTGCGCTCGTGCCGGCGGGCGTCGCCGCCGCCGAGGAGCCGGCTGAAGCCGTCGCTGCCGCGACCGGCCCGACCGTTGACGCAACGGTTACCGACCGTTACCGGGCGGGCGCGTCGGCGGGGCTGTCGCGGGTCGATACAGACGGCGTCCTCGAACAGCCGACTCGGGCGACGATATACGAAGCCATCGACGAGTCGCCGGGTATCGACCTCGCCGGACTGGCGGCGGCGGCTGACGTGACGAAGTCGACGGCACGGTATCACGTCGACGTGCTACGCGATGCCGGCCTCGTTGCGGGTGTCGAAGTCGCCGGTGCGTTACGCTTTGCGCCCGCGGAGCTCGACGCGGAGGTCGCCGGCGTGCTTGAGACGGACGCGCCGGGCACCGTGCTGACGGCGGTCGCCGACCACGAGCCGGCCTCGGTACGAACGCTGGCGGAGGCGACCGACCGCGCACCATCGACAGTCTCACACCACCTCTCGGAACTCGAAGCTCGCGGGCTCGTCGAGCGCGAACGCCGCGGTGAGGCCGTCCTCACATCGCTTGCCCCGCCGGCACGGGACGCCCTCGGGGCACCACCGGCAACAGCCGACGACTGA
pI4.2201
MW (k)21698.2
Translation (213 aa, Edit)MDRQHVAVLVAVCMALALVPAGVAAAEEPAEAVAAATGPTVDATVTDRYRAGASAGLSRVDTDGVLEQPTRATIYEAIDESPGIDLAGLAAAADVTKSTARYHVDVLRDAGLVAGVEVAGALRFAPAELDAEVAGVLETDAPGTVLTAVADHEPASVRTLAEATDRAPSTVSHHLSELEARGLVERERRGEAVLTSLAPPARDALGAPPATADD