Gene ID2060
Gene Name
Annotationhypothetical protein
Locationchromosome:1000227→1003670
Gene typeHypothetical gene
GC content0.637921022067364
Hydropathicity-0.373844812554488
DNA (3444 bp, Edit)GTGCCGTGGGAATCCCACCCCGTTCACGGGTGGGAGGAGGTCAAGGTTGCGGCAGTTGACGGAACGCCCACCATCGAAATTGAGGACGGTACTGATGAAACAGATGCGGTCGGCATTTCGGTTCCCGGCGATGATGTGACCATCCGAGATATCGAACTCGACGGCAGCGGCGGCAACGGTGACATCGACACCGGCATCAAGACGACCGCGCCCGACACTGTCGTCGAGGATGTGACTATCACAAACGCCGCCGACGGCATCAGCGTCGAGGGTGACATCGCGCTAGATGGCAGCGACAGCCGAATCGAGGGGGCAACCGTCGAAAACGCCGACCGCGGTGTCGTGGTGACCGGCTCCGCTGACACTATCGAAGCCACCAGCATCGGCCTCACGGACGACGACGCTGTCGGTCTCGTGGTGCAGGACGGCGGCGGGATAGCGACCCTTGACGAGTTCTCGGTCAAACGGGACAGCGGGACCGGTGGAACAGGTATCGAACTCCACGGAAGCGACGGCATCGACGGCCACGGCGTGACCTTCGAGAACCTCGATACTGCGTTCGTCGTCGACGACGGTACGGCAGACGTCGCGCTCACGGGTGTCGATGCAAACCCTACAGCGACCGTTGAGTTCGGCGATGTCGCCCCGGCGGCAAACAGCATCGAAATCAGCCACGATGACGGCCCACCCGTTACGGTCGGCGGCCGGGAGGCGACACTTGAACGCGACGACGACGCCCCGAACGACCCCGAAGACCTGTTCGGCATCGGTGCCGACCTCAGCCTCGAAAGCGACGGTGAGGACTCGGAACTCGACCTCACAATCAGTTACGACGGCCACGCCGCCGGCATCGTCGACGAGACGCTGGCGCTCTACCGACACGACGACGGCAACGGTGACTGGACAGACGTCGGTGACTCGACTGTCGACACGGACGAGCGCGTCGTCGAGGCGACCGTCACCGACTTCTCGACGTTCGAGGTCTACGGCGAAGGTGGGGTAATCGTCGAGGACGCGACGCTTCCGGACCGGACTGCGACCGGGGCGACGGTGAACGTTGAGGCGACAATCAAAAACCAGGGTGATTCCGAGCGGACCGGAACGGTCGAGTATCAGTTCGACGGCGATGGTGTCGACAATACCACGGTGTCGCTCGACAGCGAGGCGTCTACTGCCGTCGCCTTCGCCTACACTGTCCCCGACGATGTCGATGCCGGCGACACGTCCCACGGCATCGTCACCGAAGACGACGACACCCAGCGTGGCGATATCACCGTCACCGACGAGGCCTTCTTCGAGGTGACTGACATCGATGCGCCGGCAAGCGTCGAGCCCGACAGCCAAATGACCGTCTCGGCGCTGGTGACGAACCACGGCGAAACGGAAGGGGACCAAGACATCGAACTGCGCTTCGGGAGCGACCTCGAAGACAGCGACGATTACGAAACACTGGAAACAGAGAGTAAGGTCTCGCTCGACCCCGACGACGACTCTCGGGTTGAACTCACCGGTACCGTCCCCGATGATAACGGAAACGGTCTCAGCGACCTTGACCTCAGCGTTGGCGACGATGCCAAGGTTGGGGTGTTCTCCGATAACGATGACGACAGAACGACGACGCGCATTGCCGAAACAGTCCACACGATTTCCGGGACTGTAGAGGACAGTCAACTTGGCGAGACGCTCGAAGACATCGACATAGCGGCCGTTTCTGACGGCGATGACTTCGAAACGGCGACCGGCGAGGACGGCGAGTATGAACTCGCCGTCCCGGCCGATACGTACGACGTGACCGCTGCCGACGCCAGCGAGCGCTACGGCGCTGAAACCGAGGACAATGTCGACGCCTCCGACGGAGACGTCGCGGATGTCGACTTCGACCTCCGGCTACGTGACGGCACCCTCGTCGGAACGGTCACCGACGCGGGCACCGGCGACGCGCTTGAGGGCGCGACCGTCGCCACGACCGCCGACGGCGAGGACCGGGAGACAGAGACCGACGCCAACGGGGCGTACGAGCTGTCGCTGCCGCCCAGCGACTACGAAGGGGCGTACACGGTGACTGTCGACGCCGATGGATTCGAAGAGCGGGCCATCGACACGGTCGACGGCGCGTCGATTGAAATCGAGCCGAACGAGGAGACAACGCTCGATGTCGCTCTCGATGCCGACCCCGGAACTGTCAGCGGAACCGTCCTTGACGACGAAACTGACGACCCAATCGAGAACGCGACGGTGACTGCTGACGGCGAATCGACAGCGACCGACGAGGCTGGCGACTACGAACTCACCGTCCCCCGCGGCGACCACGATATCACAGCGAGCGCGGCCGGCTACGCGGATGCTACGGAGACTGTGTCCGTCGGTCCCGGCGAAGACGTCTCCGGCGTCGACTTCCGGCTCGACCGGATACCGGTGCTTACTTTCGAGACAGTTACCGTCCCCGAGTCGGTTGAACAGGGCGGGACGCTCTCAGCCGACGTAACCGTCGAAAACGAGGGACTGGCTGCCGGTACGGCAACCATATCGCTCGATATCGATGCGCTCAACCTCAGCAACGAGGGTGACGTTGACCTCGGTGCCGGCGAGAGCACCGACCGCTCCCTGTCGGTGTCGATACCCTCGGATGCCGACACCGGCGACTACGACGCGACGCTGTCGGTCGGCGACGAAACCGAAACCCGGACTTTCGAAGTCGAAGCGGCAACGACCGGTAACGGCGGCGGTGGTGGCGGTGGTGGCGGTGGTGGCGGCGCAGTTGGCGGCGGTGGTGGCGGCGGTGGCGGCCCGTCAACGAGCATGTCCACGGCTATCGAAGACAGCGCGCCCGGGCAGCCGGGGATTACCATCCAGACTGGCCGCATCGACGACCTCGATTCGATAACGCTGTTCGATGAGACTGCCACGGGGAGCGTCCGCGTCAACGGCTACGGTGACCGTCTGCCACCCCGTTCGCCGTCGATGGGGACACAGCCGGTCATTTCCGCCGTCGAAGTCATTGTGCCGGATGCGTACGCCGACTCCCCCGGCTCGCTCCGGTTTACCATCCATAACCGACAACTGCTGCACGCAGACACCGAGCCGGAGGAGCTTCGAGTACTCCGGGCGGTCCCGGGCGGCTACCAGCAGCTTGACACAGAGGTCGTCGGGTCTACGAACGCCGATGTGACCATTGAAGCCGAGACGCCGGGCTTTTCGGTGTTTGTCGTGTCGAACGACGGAACCGATGCGCTCGTTGATGACGAGCCGCCGGCTGTCGAGGAAGACACTCCTGATGAAGCTGACGAACCAGATACGCCCGATACGCCGACGGAGACGGACGATGACGTCCCTGAAGACGTTCCCGACGACCAGCCGGGACTCGGTGTTCTCGCAGCACTACTGGCGCTTGCTGTGGCACTTGGAGGGCGAGTCCTGCTTGCGACATGCCGCAGCGAGGCCTAG
pI3.3603
MW (k)117926
Translation (1146 aa, Edit)MPWESHPVHGWEEVKVAAVDGTPTIEIEDGTDETDAVGISVPGDDVTIRDIELDGSGGNGDIDTGIKTTAPDTVVEDVTITNAADGISVEGDIALDGSDSRIEGATVENADRGVVVTGSADTIEATSIGLTDDDAVGLVVQDGGGIATLDEFSVKRDSGTGGTGIELHGSDGIDGHGVTFENLDTAFVVDDGTADVALTGVDANPTATVEFGDVAPAANSIEISHDDGPPVTVGGREATLERDDDAPNDPEDLFGIGADLSLESDGEDSELDLTISYDGHAAGIVDETLALYRHDDGNGDWTDVGDSTVDTDERVVEATVTDFSTFEVYGEGGVIVEDATLPDRTATGATVNVEATIKNQGDSERTGTVEYQFDGDGVDNTTVSLDSEASTAVAFAYTVPDDVDAGDTSHGIVTEDDDTQRGDITVTDEAFFEVTDIDAPASVEPDSQMTVSALVTNHGETEGDQDIELRFGSDLEDSDDYETLETESKVSLDPDDDSRVELTGTVPDDNGNGLSDLDLSVGDDAKVGVFSDNDDDRTTTRIAETVHTISGTVEDSQLGETLEDIDIAAVSDGDDFETATGEDGEYELAVPADTYDVTAADASERYGAETEDNVDASDGDVADVDFDLRLRDGTLVGTVTDAGTGDALEGATVATTADGEDRETETDANGAYELSLPPSDYEGAYTVTVDADGFEERAIDTVDGASIEIEPNEETTLDVALDADPGTVSGTVLDDETDDPIENATVTADGESTATDEAGDYELTVPRGDHDITASAAGYADATETVSVGPGEDVSGVDFRLDRIPVLTFETVTVPESVEQGGTLSADVTVENEGLAAGTATISLDIDALNLSNEGDVDLGAGESTDRSLSVSIPSDADTGDYDATLSVGDETETRTFEVEAATTGNGGGGGGGGGGGGAVGGGGGGGGGPSTSMSTAIEDSAPGQPGITIQTGRIDDLDSITLFDETATGSVRVNGYGDRLPPRSPSMGTQPVISAVEVIVPDAYADSPGSLRFTIHNRQLLHADTEPEELRVLRAVPGGYQQLDTEVVGSTNADVTIEAETPGFSVFVVSNDGTDALVDDEPPAVEEDTPDEADEPDTPDTPTETDDDVPEDVPDDQPGLGVLAALLALAVALGGRVLLATCRSEA