Gene ID2056
Gene Name
AnnotationADP-ribose pyrophosphatase, GDP-mannose mannosyl hydrolase
Locationchromosome:999402→999935
Gene typeFunctional gene
GC content0.668539325842697
Hydropathicity-0.463841807909605
DNA (534 bp, Edit)ATGCCGTCGCCGTCCGCGCTACTGGACCGCTACGAGAGCCCGATTCACAAGCGGGACACCATCGAGCTGTCGGCAGACCGCTACGAAGCCGGTATCGAGCGCGGTGACGACGGCGCGTGGGGCGTCGGTGCGCTGGTCGTCTCGGCCGGCCGAGTGCTCTTTGTCCGGGAAGGCGAGACGTGGCTTCTGCCGGGCGGTAAGCTCCACGCCGACGAGTCTGTAGAGGCCGGCGCTCGGCGCGAAGTTCGCGAGGAGACGGGCATCGACATCGAACTATCGACGCTCGGGGCGGTCGCAGAACAGACCTTCCGGCATCCGGAGCGGGACGATTCCTACCAGTTCTATTTCGCCACGTTCGTCGCCGAGCCACGACCGCCGGAACCAGAGCCGACGGCGGCCGCCGAGGCTGTCGACGAGGCGGCATGGCTCCAGTCGGTCCCGGAATCGACCTTCGACCGCGAGTTGGTCGTTCGGCTGGTCGAACGTTACAGCGGTAGCGAGGCGAAAGCCCACCCCTTTCAGGGGTGTGGATGA
pI4.3094
MW (k)19473.5
Translation (176 aa, Edit)MPSPSALLDRYESPIHKRDTIELSADRYEAGIERGDDGAWGVGALVVSAGRVLFVREGETWLLPGGKLHADESVEAGARREVREETGIDIELSTLGAVAEQTFRHPERDDSYQFYFATFVAEPRPPEPEPTAAAEAVDEAAWLQSVPESTFDRELVVRLVERYSGSEAKAHPFQGCG