Gene ID2050
Gene NameglyA
Annotationglycine hydroxymethyltransferase
Locationchromosome:995650→996924
Gene typeFunctional gene
GC content0.662745098039216
Hydropathicity-0.376179245283019
DNA (1275 bp, Edit)ATGAACTACGAGCAGGTCCGCGAGGCCGACCCTGCAATCGCTGCTGCGCTTGCCGACGAGCGCGACCGCCAGGAAGACACGCTGGCGATGATTGCCTCCGAGAACCACGTCTCGGAGGCCGTCCTGCAGGCCCAGAGTTCGGAACTGACAAACAAGTACGCCGAGGGCTACCCCGGCGAGCGGTATTACGCCGGCTGCGGTCCCGCAGACGACGTCGAAGAACTCGCCATCGAGCGCGCCGAGGAGCTGTGGGGTGCCGAACACATCAACGTACAGCCCCACTCCGGAACGCAGGCGAACATGGCTGTCTATCTCGCCATGCTGGAGCCCGGCGACCGGATTCTCTCCCTAGAACTGGAACACGGTGGCCACCTCAGCCACGGCCACCCGGCCAACTTCACCGGCCAGACCTACGAAGTCGAACAGTACGAGGTCGACCCCGAGACGGGCTACATCGACTACGACGAACTCCACGAGCAGGCCGAGGCGTTCGAGCCGGACATCATCGTTTCCGGCTACTCCGCCTACCCCCGCGAGGTCGAATTCGAGCGGATTCAGGAGGCCGCCGATGCTGTCGACGCCTACCATCTTGCCGACATCGCCCACATCACCGGACTCGTCGCCGCCGGCGTCCATCAGTCGCCGGTCGGCGTCGCCGACTTCGTCACCGGCTCGACGCACAAGACCATCCGCGCCGGCCGCGGCGGTATCGTGATGTGTGACGAGGAGTACGCCGACGATATCGACGCTGCCGTCTTCCCCGGCGCACAGGGCGGTCCGCTGATGCACAACGTCGCCGGCAAGGCCGTCGGCTTCAAGGAGGCGCTCCAGCCCGAATTCGAGCAGTACGCCCAGCAGGTTATCGACAACGCCGAGGCGCTCGGCGAGCGGCTGCAGGAACACGGCTTCTCCCTTGTCTCCGGCGGCACCGACAACCACCTCGTGTTGGTCGACCTTCGGGAGTCCCATCCCGACACGAGCGGCACCGTCGCCGAGGAGGCCCTCGAAGCGGCCGGCATCGTTCTCAACAAAAACACCGTGCCCGGCGAGACCCGGTCGGCGTTCAACCCCTCGGGCATCCGCGCCGGCACGCCGGCGCTGACGACCCGCGGCTTCGACGAACAGGCCTGCGAGCGCGTCGCCGACATCATCGCCAACGTCATCGACAACCCTGACGACGAGGGGACCATCGACGAAGCCGCCGCGGAGGTCGACGCCCTCTGTGAGGAGTACCCGCTCTACCAGGGCGAAAGCGGCATCACCGACTTCGAGTAG
pI3.9356
MW (k)45730.8
Translation (423 aa, Edit)MNYEQVREADPAIAAALADERDRQEDTLAMIASENHVSEAVLQAQSSELTNKYAEGYPGERYYAGCGPADDVEELAIERAEELWGAEHINVQPHSGTQANMAVYLAMLEPGDRILSLELEHGGHLSHGHPANFTGQTYEVEQYEVDPETGYIDYDELHEQAEAFEPDIIVSGYSAYPREVEFERIQEAADAVDAYHLADIAHITGLVAAGVHQSPVGVADFVTGSTHKTIRAGRGGIVMCDEEYADDIDAAVFPGAQGGPLMHNVAGKAVGFKEALQPEFEQYAQQVIDNAEALGERLQEHGFSLVSGGTDNHLVLVDLRESHPDTSGTVAEEALEAAGIVLNKNTVPGETRSAFNPSGIRAGTPALTTRGFDEQACERVADIIANVIDNPDDEGTIDEAAAEVDALCEEYPLYQGESGITDFE