Gene ID2014
Gene NameureG
Annotationurease accessory protein
Locationchromosome:981263→981883
Gene typeFunctional gene
GC content0.658615136876006
Hydropathicity-0.0932038834951456
DNA (621 bp, Edit)ATGGGGCACAGAGATGTCGCAACCGTCGGCCTCGGCGGACCGGTCGGCTCCGGCAAGACCGCGATGGTCAAACGGCTCGTCCCGCGGCTCGATGCGGCCGGCTACAACGTCGGCGTCATTGCCAACGACATTATGACACAGGAGGACGCCGACCGGCTCAGGGAGTCCTTCGAGGGGATTCTCCCGCCGGACCTCGTCGAGGGCGTCGAGACCGGTGCCTGTCCGCACACTGGCATCCGCGAGGACCCCTCGATGAATATCGCGGCTATCGACGAGTTCACCGAGTCGTATCCGGACCTCGATGTGGTGTTGCTCGAAAGCGGCGGCGACAACCTCGCGGCGACGTTCAACCCGGAGCTGGCCGACTACTTCATCTTCGTCATCAGCGTCGCCGAGGGCGACGACATCCCGCGCAAGCGCGGCCCCGGCGTCACGCAGGCCGATTTGCTGGTCGTCAACAAGACGGACCTCGCACCCCACGTCGACGCCGACCTTGAGGTAATGCGCCGGGACGCCGAGACGGTTCGCGGCGACGCGCCGACCTGCTTTACCGACTGCAAGGCCGAGGAGGGAATTGACGGCGTCGTCGACCACATCGAGGAGGGGGTTCTCTTCGCGTGA
pI3.9969
MW (k)21950.6
Translation (205 aa, Edit)MGHRDVATVGLGGPVGSGKTAMVKRLVPRLDAAGYNVGVIANDIMTQEDADRLRESFEGILPPDLVEGVETGACPHTGIREDPSMNIAAIDEFTESYPDLDVVLLESGGDNLAATFNPELADYFIFVISVAEGDDIPRKRGPGVTQADLLVVNKTDLAPHVDADLEVMRRDAETVRGDAPTCFTDCKAEEGIDGVVDHIEEGVLFA