Gene ID4198
Gene NamednaK2
Annotationchaperone protein DnaK
LocationII:179983←181575
Gene typeFunctional gene
GC content52
Hydropathicity-0.305094339622642
DNA (1593 bp, Edit)ATGACACTATCCAATCTTCCAATCGGGATTGACCTCGGCACTACCAACAGTGTCGTCGCAACCGTCTCCGACGGCGGATTTGAGGTTGTCCCAAATGCGCGTGGAGACAAGAAAACGCCCTCAGTCGTCAGCTACGATCAAGACTCCCAGAGTGTGTTTGCCGGCAGGCAGGCCGATAATCGAGCCATTCACCATCCTGAGAAGACGGTCAAATCAGTCAAGCGCCACATGGGGACAGACGAAACGTTCTCACTTGGACCAGATCAATATCATCCCGAAGAAATCAGTGGCCTCATCCTCAAGAAACTCATTGAAGACGCCGGAAATGAACTGAATCGACCCCTCTCTAACGCCGTCATTACCGTCCCAGCATATTTTTCAGATGCACAGCGCCGCGCTACCAAACGAGCCGGGGAAATTGCTGGGATCGATGTCGACCGCGTGCTTCCAGAGCCGACAGCCGCCTGTCTCGCCTATGGACTCCAATCTACAGCCGGAAAGCGGGTCCTCGTTTACGACCTTGGCGGTGGCACCTTCGACTGCTCGGCCGTGAAGATCGATGACGGTGTCATTGAAACTTTAGGCGTCGACGGAGCGACTGATCTTGGGGGCGACGACTACGATAGTCTCATAGTTAATTGGGTTGCTGATACCATTGCAGACGAATACGGGAGTCCTCCTGCTCTTAATAATCCGAAGGTTAATCAGCGACTATTCGGAGCAGCGAAAGAAGTCAAACACGAGTTATCGAGCCGAACATCGGCAATTCATCAACTCCCCTTCCTTGAACTTCAGAATGGGGACACCATTGATTATGAGTTGAACATAACCCGGGGAGAATTTGCTGAGATCACTGCCGGCCCAACTCAAGAAACAATCGACATCATGAACGGATTCCTCAACGACCTTGGACTCACCCCCAGTCAATTCGACGACGTCCTCTTGGTTGGCGGAGCTACTCGGATACCCGCCATCAGGTCTGCCGTCGAGCAGTTCTTCGGGCAGGAGCCTCGGACAGACCTCAACCCAGACCAGATCGTTGCGTTAGGGGCCGCTACACAGGCAGCCATCTTGAATGACATCGAAGTTCCAGCAGTTTCTACCACAAATATTGTTCCATCTACCGAAGTATCCCAAGGGGAAGCCGCTATCAACGAGGGTTCAAACCCAATCCTTATTGATGCACTGCCCCGGACACTTGGCGTTGAGCTTCAGGAGCCAAAAACGAACGATACCTACTTCCAACCGCTCATACAAAGCGGGGAGTCAATCCCAGCACGTGCTGAAATCAACGTCACCCCTGTTCGAGCACACCAAACTAAAACGAGGTTCACAATCTACCAGGGGGACGAAGGGACACTCGAAGGAAACGACGAAATCGGCGAACTCGTTCTTGGCCCGTACCCGCCGAAAGAATTAGACGAGTACAGCCAGCGTGCCACTATGGAGATCGATTCTGACGGAATTATCACTTTCACTGCCGTTTCACTTGATGCAGATGTATCGGACACGACCGAAATCGAAACTCGATTTAATAGAGAAGAAGAGACGCTCGGGGGCACGAATCCTGACCTTCCCGCTCTTCACCGATAG
pI4.1394
MW (k)56999.3
Translation (529 aa, Edit)MTLSNLPIGIDLGTTNSVVATVSDGGFEVVPNARGDKKTPSVVSYDQDSQSVFAGRQADNRAIHHPEKTVKSVKRHMGTDETFSLGPDQYHPEEISGLILKKLIEDAGNELNRPLSNAVITVPAYFSDAQRRATKRAGEIAGIDVDRVLPEPTAACLAYGLQSTAGKRVLVYDLGGGTFDCSAVKIDDGVIETLGVDGATDLGGDDYDSLIVNWVADTIADEYGSPPALNNPKVNQRLFGAAKEVKHELSSRTSAIHQLPFLELQNGDTIDYELNITRGEFAEITAGPTQETIDIMNGFLNDLGLTPSQFDDVLLVGGATRIPAIRSAVEQFFGQEPRTDLNPDQIVALGAATQAAILNDIEVPAVSTTNIVPSTEVSQGEAAINEGSNPILIDALPRTLGVELQEPKTNDTYFQPLIQSGESIPARAEINVTPVRAHQTKTRFTIYQGDEGTLEGNDEIGELVLGPYPPKELDEYSQRATMEIDSDGIITFTAVSLDADVSDTTEIETRFNREEETLGGTNPDLPALHR