Gene ID1904
Gene NameilvB_2
Annotationthiamine pyrophosphate-requiring enzyme (acetolactate synthase 2, large subunit 2; benzoylformate decarboxylase )
Locationchromosome:925666→927360
Gene typeFunctional gene
GC content0.640117994100295
Hydropathicity-0.154255319148936
DNA (1695 bp, Edit)ATGGCAGAATCCGACACCGGCGCGGAGCTTTTCGTCGACGCGCTCGAATCCTACGGCGTCGAGCACATCTTCGGTAACCCAGGGACAACCGAACTCCCCGTTCTCGATGCTATCTCCGAAAGCGACATCGAGTACATTCTCGGACTGCAGGAAGACATCGCTACCGGGATGGCGGCTGGCTACGCCTCAACTCGCCGCTACCACGCCGAAGACGACGCCGACATCTGTCCGGTCGGTGTCGTCAACCTCCACGTTACGCCCGGGCTGGCACACGGTCTCGGGAACGTCTTCGGTGCGATGTACAGCGGTGCGCCGGTCGTCGTCACTGCCGGCAACCACGAACTCGACTTCCGGCACGAAGAGCCCATTCTGACCGGCGACCTCGAAGCGATGGTCGAGCAGTTCTGCAAGTTCTCCGCGGAGGTAACGCACGTCGACTCGCTACCGATGCTGCTCCGTCGGGCAGTCAGGACGGCGCTGACGCCGCCGACCGGCCCCGTCTTTCTCGCGTTGCCCGCCGACGTGATGATGGCCGAGACCGACGCCGACCCGGAGCCGCTGGGGCCGATTCCGGACGCCGGTGGCGGCGACCCGAATCAGATTGCTACTGCGGCCGACTACTTTGTCGAGGCCGACCAGCCCGTGTTGGTCCTCGGCGACCACGTCGCCCGCGCCGGCCGCGATGCCGTCGAAGCGGCCGTCGAACTCGCGGAGGCGACGGGCGCGCGCGTCCACGGCGAAATCCTCGCTAGCGAAATCAACTTCCCGACCGACCACGACCAGTGGGTGTCGTTTATCGGTCCCGACGAGTCCATCGCCTCGATGCTGATGGACACCGATACGCTCGGCTTGGTCGGCTGCTCGACGAACACGACGCTGTTGCGTCATGAGTCGCCCCTTATCGACGCCGATACGACGACCGTACAGGTCTCCAGCGACCCCGACGAGGTCGGCAAAAACCATCCCGCCGATGCCGCCGTCATCGGCGACCCTGGCCGTATTATGCGCGCCATCGCCGAACGGGTCGACAAGCGTCTTGACGACGACGAGCAGGCCGCCCGCATCGACCACGTCGAAACGATGAAGGCGAGTCTCGAACCGACGATGCAGAGCCTCGGTGAGGACGAAACGCCCCCCGGCGACACGCGGTCGTCGAAGGCGGAACTCGTCGATACGATGGCCGCCGTCGAGGAGGACGTCTTCATCGTCGACGAGGGCGTCACCTCCAAGTTCGCATTGCTGACACGGTTCCCGCTGGACGTACAGGGGTATCTCTCGAACAAGGGCGGCGGCCTCGGCTACGGGCTGCCGGCCGCCGTCGGGGCGGCGCTGGCGGAATCGCTTCGAGATGACCCCCAAGAAGTCGTCGGCTACATCGGCGACGGCTCCTATCTCTACTACCCGAACAGCATCTATTCGGCGACCCGATACGACCTCGACCTGACCGTTGTGGTTCCAGACAACCGCAACTACCGCATTCTCAAGGACAACACGGTCGCGATGATGGGCGGCGACGAATCCGACTACGACTTCGTGGGGATGGATTTCGACCCGCACGTTGACATTCCGAAAAACGCTGAAAGCCACGGAGCACGCGGCCATCTCGCTGAAACGCCCGAGGAATTCGAGGACATCTACGCCGAGGCGCTGGACAGTTCGGGGACTGACGTTATCGACGTTCTCGTCCACGACTGA
pI3.9147
MW (k)60230.7
Translation (563 aa, Edit)MAESDTGAELFVDALESYGVEHIFGNPGTTELPVLDAISESDIEYILGLQEDIATGMAAGYASTRRYHAEDDADICPVGVVNLHVTPGLAHGLGNVFGAMYSGAPVVVTAGNHELDFRHEEPILTGDLEAMVEQFCKFSAEVTHVDSLPMLLRRAVRTALTPPTGPVFLALPADVMMAETDADPEPLGPIPDAGGGDPNQIATAADYFVEADQPVLVLGDHVARAGRDAVEAAVELAEATGARVHGEILASEINFPTDHDQWVSFIGPDESIASMLMDTDTLGLVGCSTNTTLLRHESPLIDADTTTVQVSSDPDEVGKNHPADAAVIGDPGRIMRAIAERVDKRLDDDEQAARIDHVETMKASLEPTMQSLGEDETPPGDTRSSKAELVDTMAAVEEDVFIVDEGVTSKFALLTRFPLDVQGYLSNKGGGLGYGLPAAVGAALAESLRDDPQEVVGYIGDGSYLYYPNSIYSATRYDLDLTVVVPDNRNYRILKDNTVAMMGGDESDYDFVGMDFDPHVDIPKNAESHGARGHLAETPEEFEDIYAEALDSSGTDVIDVLVHD