Gene ID1900
Gene Name
Annotationdehydrogenase/ reductase 5
Locationchromosome:923743→924519
Gene typeFunctional gene
GC content0.626769626769627
Hydropathicity-0.0612403100775193
DNA (777 bp, Edit)ATGTTAGAGCAGTTCAGTGTCGAGGGCCAAACGGCCGTTATCACCGGCTCCAGCCAAGGCATCGGCGCTGTAACCGCAAAGCGGTTCGCCGACGAGGGCGCAAACGTCGTCGTCACCTCACGCACACAGGAACAGATTGACGAAGTCGCCGACGAAATCAACGACAGCGACCGACCGGGCGAGGCCATCGCCGTCGAATGCGATGTCCGGGAGCGCGAGGCCGTCGAAGCGCTCGTCGAGGCAACCGTCGATGAGTTCGGCCGCATCGATTCGATGATAAACAACGCCGGGGCCTCGTTCATGGCAGGCTTCGACGACATCTCCGAGAACGGCTGGAAGACCATCGTCGACATCAACCTCCACGGGACCTTTCACTGCTCGCAGGTCGCCGGCCAGCAGATGCAGTCCCAAGACGGCGGCGGCACCATCGTCAACTTCGCCTCCGTCGCCGGCACGATGGGGTCGCAGTATATGAGCCACTACGGAGCCGCCAAGGCGGCCGTCGTCAACCTGACAACATCGCTTTCGGCCGCCTACGCCGACGAGAACATCCGCGTCAACTGCATCGCGCCGGGGCTTGTCGGCACGCCGGGGGTCGCCTCCCAGATGGGTCTCGACCCCTCCGATGTCGACCGCGAGGATGTCGCCAAGGAAATGGGCCTGCCGGAGGAGATCGCGGACATCGTTCAGTTCCTCGCCAGCGATGCCGCCTCCTACATCGTCGGCGAAACAATAACGGCACAGGGAGTCCCACCACTAGAGGATTCAAACCTCTAA
pI3.7785
MW (k)27013.8
Translation (257 aa, Edit)MLEQFSVEGQTAVITGSSQGIGAVTAKRFADEGANVVVTSRTQEQIDEVADEINDSDRPGEAIAVECDVREREAVEALVEATVDEFGRIDSMINNAGASFMAGFDDISENGWKTIVDINLHGTFHCSQVAGQQMQSQDGGGTIVNFASVAGTMGSQYMSHYGAAKAAVVNLTTSLSAAYADENIRVNCIAPGLVGTPGVASQMGLDPSDVDREDVAKEMGLPEEIADIVQFLASDAASYIVGETITAQGVPPLEDSNL