Gene ID1882
Gene Name
Annotationsignal-transducing histidine kinase
Locationchromosome:912252→914882
Gene typeFunctional gene
GC content0.637780311668567
Hydropathicity-0.042351598173516
DNA (2631 bp, Edit)ATGGACGCCATAATGATACAGCAGGGATACATCGCCGTCTTTGCCCTCACGGGCGTCGTCTGTCTGCTCGCAGCGACGACTGTCCGGAGCTTCACGAATCCGGATGTCCGCCGAGGGCTTGTGGGACTGCTCGCACTCAACGGCTTCTGGTCGCTGGCGACAGCGGTCCAGTTGGCCACGACAGCCCACCCGGTCGCCCGAGCAATGCACATTCTGGCGCTCGTGCTCGGAATCGCGACGGTGTTCGCGTGGCTCGCGTTCGCGTCCGCCTACTCCGGCCGCGAGTACCACCGACAGCGCACGCTACAGGCCGCCGGGGCGTTCGTGTATCTCGCCATCGTAGCTGTGAAGGTCAGTAATCCGCTTCACGGGCTGTATTTCGCCACCTCGGTCGTCGCTGACCCGTTTGCTCACATCGCAATCAGCTATCACGCGTTCCACTGGTTCGTGACGGGCTTTGCCTACACGGCCGCGGGCGTCGGATTCCTCTGGCTGTTCGAGTCGTTTAACCGCAACAGCGCGGGCGGAACAGCCGAATGGAGCGCACGGCCGGCAGCACTATACGTGCTCGTGGCCGCCACTGCGCTTCCCATCGTCCCGTACGGGCTGTCCTCGTACTCTGACCTACTGATTCGGACGAACTACGAGCCGCTCGGCGTCGCCGTGTTCGCTCTCGGCGTCTCGCTGTACGCCCGAGCGGAGTTTCGCCGACACAGCTCGCCCAGCCACTCGGCGCTTGTCGATGGGCTCTCCGACGGCGGGCTACTTGTCGACGAGTCGGAGACGGTTATCAACGCCAACGAGCGTGCAGCGGAGATTCTCGGCCGTTCGTACGTCCCTCGCGTCCCGCTCGCGGAGCTCGATACGGAACTGGCGTCGCTGGAGACGGGGGAGACAACGCGGATTACTCGGTCGGTCGGCGGCGACGAGCGGGTGTTCGAAACACACCGCCTCACTGCCGAAGACTCGCCCATCGCCGCAGAGATGGTCACCCTGAAAGACGTGACGAGGGTTTCCCGCCTCGAGCAACTGATGGGCATCCACCGGGACATCAACGAGGCGTTGATAGACGCTGCCGAGCCGTGGCAGTTCGTCCGCGAACTCCCCGACCAGTTCGCCGCCATCGACGCCTACGAGTTCGTCTGGCTCTACCCGGTTGCCGACGACAGCAGCGATGGCTCGCTAGATTCATCAAGCTGGACGGCTCCCGACGACTCGCTTGACGACGGATTCGGAGCCGTCGCCGGCGACGCGGCGGCCTACCCCCGATGGGCGGACGCCGAGGCCAGTTCGACGGAGCCAGTTCTCACCGCGGCTGCTCGCCGGCAGGCGACCCGGGTCGGCGTCTCGAAAACGGACGCCGAGTGGGCACGCCGCCTCTCGGAGCGCGGTGTCACCGACTGCCTTGCCGTTCCGGTTGCTGTGACCGACGAGCAGCCGGTCGTTCTCGGCGTCTACACGACCGACTCCAATGGCTTCGACGCCGCCGAGACGCAACTCATCGAGGAAATATGCCGGCTGGTTCCCGAGGCGGTGCGGCGTATCACAGCCCATCGTGATGCGCTCCGATATAAGGAGGCGATCACGCACACGGCCACAGCCGTGTTCATCACCGACACCGACGGCACCATCGAGTACGTCAACCCGGCGTTCGAGCGCCTCACCGGCTACTCTAAACGGGAAGCCATCGGTTCAACCCCGTCGATGCTGCAGTCCGGGGACATGGACGACGACTACTACGACCAGCTGTGGGATACCATCAACGCTGGTGAGGTGTTCAAAGAGCGGATTACGAACAAGACGAAACACGGCGACCGCTACATCGCCGAACAGACAATTTCGCCCATCTTGGATGACGATGGCTCCCCGAGTGCTTTCGTGGCAATCCAGTTTGAGGTGACAAACCGGATGCTTCGTGAACAGCGGCTGTCGGTGCTGCATCGGGTGCTTCGTCATAACCTCCGGACGAATCTGAACGTCATCGACGGCCACGCGACGCTGGTCGAAGACCAACTTGACGCCGCCGCAGACGCCGATACAACACTGGAAGCAGCGAACGACTCCCTCGAGACGATTCGGGCACACACGACGAAGCTCGCCGACCAGTCAGCGACGGCACAACGAATCGAGCAGGCGCTGTCGAACGACCGGAGCGGCCGGACCTGTCTGCCGGTCGCCGAATTGGCCACGACCGCTCGCGAAACCGCCGAGCGACTCGGTGGAACCTGCGAGGTGGCGGTTCGAATGGACCGCTGTCGGCAAATCGATGCCGAACTGCGGCAGGTCGTCGAAGAGCTTGTCGAAAACGCCGTCGTCCACAACGACGCACCGCCGGCCGAAGCCACTGTCCGGCTTACGCTGGAGCAGGACGGGAACGAGTTGGTCCTCGTCATCGAAGATGACGGCCCCGGCATCCCGGACACCGAACTCGTCTTTACCGAAGAGGGCACAGAAGAGCCACTCCACCACAGCAGCGGCCTTGACGTGTGGCTGGTGAAGTGGCTCGTCGTCTCTATCGGCGGCTCGGTTACCGTCTCGACTGATGACGACGGAACGTCGGTTCGTGTAGCCGTCCCCATCCGCAGCCCTGACGCCGCCGAGCCGGAAGCGGCACAGACCGGCCTCGATTAA
pI4.3896
MW (k)95120.5
Translation (875 aa, Edit)MDAIMIQQGYIAVFALTGVVCLLAATTVRSFTNPDVRRGLVGLLALNGFWSLATAVQLATTAHPVARAMHILALVLGIATVFAWLAFASAYSGREYHRQRTLQAAGAFVYLAIVAVKVSNPLHGLYFATSVVADPFAHIAISYHAFHWFVTGFAYTAAGVGFLWLFESFNRNSAGGTAEWSARPAALYVLVAATALPIVPYGLSSYSDLLIRTNYEPLGVAVFALGVSLYARAEFRRHSSPSHSALVDGLSDGGLLVDESETVINANERAAEILGRSYVPRVPLAELDTELASLETGETTRITRSVGGDERVFETHRLTAEDSPIAAEMVTLKDVTRVSRLEQLMGIHRDINEALIDAAEPWQFVRELPDQFAAIDAYEFVWLYPVADDSSDGSLDSSSWTAPDDSLDDGFGAVAGDAAAYPRWADAEASSTEPVLTAAARRQATRVGVSKTDAEWARRLSERGVTDCLAVPVAVTDEQPVVLGVYTTDSNGFDAAETQLIEEICRLVPEAVRRITAHRDALRYKEAITHTATAVFITDTDGTIEYVNPAFERLTGYSKREAIGSTPSMLQSGDMDDDYYDQLWDTINAGEVFKERITNKTKHGDRYIAEQTISPILDDDGSPSAFVAIQFEVTNRMLREQRLSVLHRVLRHNLRTNLNVIDGHATLVEDQLDAAADADTTLEAANDSLETIRAHTTKLADQSATAQRIEQALSNDRSGRTCLPVAELATTARETAERLGGTCEVAVRMDRCRQIDAELRQVVEELVENAVVHNDAPPAEATVRLTLEQDGNELVLVIEDDGPGIPDTELVFTEEGTEEPLHHSSGLDVWLVKWLVVSIGGSVTVSTDDDGTSVRVAVPIRSPDAAEPEAAQTGLD