Gene ID1864
Gene Name
Annotationhypothetical protein
Locationchromosome:904123→905562
Gene typeHypothetical gene
GC content0.65625
Hydropathicity0.487473903966598
DNA (1440 bp, Edit)ATGCCCTCCCCTGGCCCGCCACGTGGGACGACGCGCCCCCTCACCTTCGCCCCGATGTTCTTGGCGAACCTGCTGCCGCTCGTGGGAGTCGTTTGGCTCGACTGGAGCGCGGAAACACTGGTCATAATATACGTCGTCGAAGTCTTGGTCGTCTTCCCGCTTGCCGGTCTGAAAGCGCTCTTTGCTCAACAGCCCCCGAAAGAAGACCGCGAAAGCGGCGTCATCAGTGTCACAGAGAGCGACCTCGTCGACAAACACGGCAGCGTGACCATTCACGAGCGGCTCCCGCCGGTGTATCCGCGGAATCTCCCGTTTGCATCCAACGTCATCGCGTTCACCGTCTGGGTCGCCATCTTCGTCGGCGTCGCCATCTCGGGGCTTGGCCCGCTTGCTGATGCCGTTCATATCCCGACAGTCCTCGTCGCCGTGGGCGGACTGCTCATCGGCCATGTTGTCGAGCTGTGGCGGGAGTACTTCGGCCAGCGCCGCTATGAAGACGTTTCGCCGTATGCAGTCGTTGAAACCCCCGCCAGACAGGCGTTTTTGCTGATGTTCCTCCTGATTGTGCTGCCGCAGACCCAACCGACCGCTGGCACGTTCGTGCTGGGCGCGTTCGTCTTTGTCAAGCTGCTCGTCGATTGGTCCGGGTTCCGCGCCGAACGCGGCGGTGGCGGCCGGCTTACCGGCTGGCTTTCCGGCCCCGAGCCGGACGCCGAAGCGTCTGCGGCAGCGCCGGAGCCGCCGTCGGTGCCCGATGCGGACCCATCGGAGGTCGTTGCGACGAGCCGCCGGTCGGCAGCCCTCGCTGCCGCAAGCGCGGCGCTCACGAAGCGGGCCCCGTTCCACGTTCCCTACCTGTTCGTCCTGTGGGTGCTCGTCAGTGCGTTCGGCCTTGGCGGCGACGCGTCGCCGCTTGCTGCCCTCGCGGTCACGGGCATCATCATCGGACTCTTCGGCGTCATCGTCGCCGGCGACGTTCTCGAAGAGATACTCCGCCACGACGCGATGGAGTATCGCCGCTGTGGCGACCACCTCGTTGCCTACGATACCCGGCTTGAGACGCCGCAGTGGGCAGCCCCCGTCGACACGCTCCGCGGTGTTGACCTCGTCTGCGACCGCTTTGCCGACCGGTATTACGGAACGCGAACGGTCACCGTCACGACCGGCTGGGGCGACAGCGAAACCGAGCGCCTTGTCGGTCCGGTTGACGACCCCGAAACGCTCGTTGCGGCGTTCGAACTCCCGATTAGCGACACCGACCTCACGCCGTTCGACAGGCGGGTCGGCGCAGCGGTGGTGGCCGGAGCAGTGCTCGTGGTTGTTGCCGCTGCTGCAATGGCTTTTCTGCCGTCCGTGCCGCCCGGTGGGCTGTTCTACCTGTTTTTCCTTTTTCCGGTCGTCGCGCTCACGCTGCGCGGAGTGTGGCGGCTGGGGTACTAG
pI4.7001
MW (k)51315.5
Translation (478 aa, Edit)MPSPGPPRGTTRPLTFAPMFLANLLPLVGVVWLDWSAETLVIIYVVEVLVVFPLAGLKALFAQQPPKEDRESGVISVTESDLVDKHGSVTIHERLPPVYPRNLPFASNVIAFTVWVAIFVGVAISGLGPLADAVHIPTVLVAVGGLLIGHVVELWREYFGQRRYEDVSPYAVVETPARQAFLLMFLLIVLPQTQPTAGTFVLGAFVFVKLLVDWSGFRAERGGGGRLTGWLSGPEPDAEASAAAPEPPSVPDADPSEVVATSRRSAALAAASAALTKRAPFHVPYLFVLWVLVSAFGLGGDASPLAALAVTGIIIGLFGVIVAGDVLEEILRHDAMEYRRCGDHLVAYDTRLETPQWAAPVDTLRGVDLVCDRFADRYYGTRTVTVTTGWGDSETERLVGPVDDPETLVAAFELPISDTDLTPFDRRVGAAVVAGAVLVVVAAAAMAFLPSVPPGGLFYLFFLFPVVALTLRGVWRLGY