Gene ID1860
Gene Namehtr26
Annotationtransducer protein htr26
Locationchromosome:901264→903249
Gene typeFunctional gene
GC content0.629405840886203
Hydropathicity-0.474886535552192
DNA (1986 bp, Edit)ATGACATACCTCGACAGACTACGGGCGATGCTGGCACGGTTGCGACCCGGCGGCGGGTCCTCCGACAGCGCTGGCGACGCCGAGACGACGGGCGGCGCTCGGACGACGAAACGACCCGACGGCGGACGAGCGATGCAGGCGGGCGATGCACCGGCGCTTGAAGACATCGGCCTTCGAAGCGAGATTGACGAGACACAGCTGTTGTCGGCGATTGGTCTCGATGACGACGAAATCGACTGGCGAAAGGAGTTCGTCGGCTTCGATGAGACTGACGCCGAGCGGCTGTCGTCGCTGACGCCCGTCTTCGAGGAGATGGCTGACGACGCCGCCGACCACTTCTATGACCACCTCGGCCAGTACGAACAGACGCGGTCGATACTGGACCGGTCGGACCGTTCTGTCGACGAACTTGAGTGGACGCAGAAACGGTACCTGCTGAGCCTCGGTGACCATCCCTACATCCCCGGTGGCGCTCCCGGCTACGGACGAGAGTACTTCCGGCAGCGGGCGATTATCGGCAAGCTACACGAGCGGCTGGACATGCCACCGAAGCATTACATCGGCATGTACGGCCAGTACCACGATATGGTGGTCGAAGAGCTGTTCGACCGCCTCGAAGACGAGGTCGACGGCGACGCTGCCACGGCTGTCGCCGACACCCGCGACCAGCTTAGGTCGTTCCTGAAGGTCACGAATCTCGATTTGCAGGTCGCGATGGACGCCTACCTCCAGTCCGGCGAGCAGATATGGATTAACGCCCTCGAAGAACTCCTTCAGCCGGTTATCGTTCTCGACAACGAGGGCGAGGTACTGTTGTTCAACGACGCGATGGAGGAGCTGACGGGTGTCACGAAGGACGATGCACACTCGATGGAGCTGTGGGAGATCTATCGGACCGACGAGACCCACGACACGAAACAGACGATGCTCGATGTCGTCTTGGAGACCGAAGACCCGATTCGGGAGAACGAAATCGAGCTACTCACCCACCACGACGAGCGGCGCCACGTCGTCCTGTCGAGCGTGCCGCTGTATGACGACCACGGCGCGCTCGTCGGCGGTGCGACAATCATCCAGGACATCACCGACCTCCGGGAACAGGAAGCCGAGCTTGAACGCCGACGTGAGACCGCGACACAGATAGAGGCCGCCATCGCTGAACTCCGCGATGCGACCGCAGCCGTCGCCGAGGGCAGCGACGAAATCGCGGCGCTGGCTGACCGGCAGCGCGACGACGTGCAAGGTGTCGCCGACGAGGTGTCGAACATCAGCGCCTCTATCGAGGAGGTCGCCGCCAGCGCTGACCAGGTGCATACGGCGAGCAACGAGACGGTTTCGCTGGCGACTGACGGACAGGAGGCGGCCGGGGAGGCACGCGAGCTGATGGAACAGCTTGATGCGGACCGCGCGGAGATGCTTGATGACATCGACGACCTTCGGGACGCCGCCGAGGAAATCGGCGACATCGTCGACATCATCGACGACATCGCCGAACAGACGAACATTCTCGCACTGAACGCGTCCATCGAGGCTGCCCGCGCCGATGAAGCCGGCGATGGCTTTGCCGTCGTCGCCGACGAGGTCAAGTCGCTGGCTGAAGAGTCACAGCAGCAGGCCGCCGAAATCGAGTCACTCGTTGCGGCCGTTCAGGAGAACACCGAAGAGACAGCGGCGAACTTAGAACGGACCGGCGAGCGCGTCGGCGACGGTGTCGACCACGTCGAATCGGTCCTTGAGAAACTCGACGCCATCGTTGCCGCCGCCCGCGAGACTGCCGACGGTATCGAGGAGGTCGCAGAAGCGACCGACGGTCAGGCCGCAAGCACCGAAGAGGTCGCGGCGATGGTCGACCAGACCGCAGCGCAGGCCCGTGATGTCGCGACCGAAATCGAAGACATCGCCGAAGCCGCCCAATCACAGCTGGAACAGGCACAGACCATCGAAGAAGGGATTACGGAGCTAACACAGACAGACGACGAGACGTAG
pI3.8305
MW (k)72458.9
Translation (660 aa, Edit)MTYLDRLRAMLARLRPGGGSSDSAGDAETTGGARTTKRPDGGRAMQAGDAPALEDIGLRSEIDETQLLSAIGLDDDEIDWRKEFVGFDETDAERLSSLTPVFEEMADDAADHFYDHLGQYEQTRSILDRSDRSVDELEWTQKRYLLSLGDHPYIPGGAPGYGREYFRQRAIIGKLHERLDMPPKHYIGMYGQYHDMVVEELFDRLEDEVDGDAATAVADTRDQLRSFLKVTNLDLQVAMDAYLQSGEQIWINALEELLQPVIVLDNEGEVLLFNDAMEELTGVTKDDAHSMELWEIYRTDETHDTKQTMLDVVLETEDPIRENEIELLTHHDERRHVVLSSVPLYDDHGALVGGATIIQDITDLREQEAELERRRETATQIEAAIAELRDATAAVAEGSDEIAALADRQRDDVQGVADEVSNISASIEEVAASADQVHTASNETVSLATDGQEAAGEARELMEQLDADRAEMLDDIDDLRDAAEEIGDIVDIIDDIAEQTNILALNASIEAARADEAGDGFAVVADEVKSLAEESQQQAAEIESLVAAVQENTEETAANLERTGERVGDGVDHVESVLEKLDAIVAAARETADGIEEVAEATDGQAASTEEVAAMVDQTAAQARDVATEIEDIAEAAQSQLEQAQTIEEGITELTQTDDET