Gene ID907
Gene NameHuta_0907
AnnotationDNA repair and recombination protein RadB
Locationchromosome:874977→875660
Gene typeFunctional gene
GC content0.67
Hydropathicity-0.289867841409692
DNA (684 bp, Edit)GTGAGCGACCCGATCTCGACCGGCTGTGACGCCGTCGACGACCTGCTCGGCGGGGGACTCGAACGTGGTGCCGTCACGCAGATCTACGGCCAGCCGGCGGCCGGGAAGACCAACCTCGCACTGGGGGCAGCCGTCGAAACGGCCGCGGCGGGGGAGTCAGCACTCTACCTCGACACCGAGGGCGTCTCGATCGACCGCTTGGAGCAACTCGCCGACGCCCGCGGCGACGTGTCGGAACTCGCTTCGCGGATCATCCTCACCGAGGCCCACACCTTCGAGGAACAACAGGAGGCAGTCCGCGACGCCGAGGAGTTCGCCAGTCAGGTCGATCTGATCGTGCTGGACAGCGCGACGGGATTCTACCGGCTGGAGCGCACTGAACAGGAAGACGGCGAGGCGCTGCGGGCGGTCGCCCGCCAGATCACACATTTGCTGGCCCTGGCCCGTAAGCACGATCTCGCCGTCGCCTTTACCAATCAGGTATTCAGCGATCCTGACGGCGATCGGGTCCGGCCCCTGGGCGGCCACACGCTCAATCACTGGTCGTCGCTCGTCCTCCGGCTGGATCGCTTCCGCGGCGGCAAGCGTCGCGCCACGCTGGAGAAACACCACGCGAAGGCGACCGGCGACACCGCCCGTTTCCAGATTACGGACGCCGGTATGTCTGGCGTCGAAGAGATCTGA
pI4.5814
MW (k)24453.1
Translation (226 aa, Edit)MSDPISTGCDAVDDLLGGGLERGAVTQIYGQPAAGKTNLALGAAVETAAAGESALYLDTEGVSIDRLEQLADARGDVSELASRIILTEAHTFEEQQEAVRDAEEFASQVDLIVLDSATGFYRLERTEQEDGEALRAVARQITHLLALARKHDLAVAFTNQVFSDPDGDRVRPLGGHTLNHWSSLVLRLDRFRGGKRRATLEKHHAKATGDTARFQITDAGMSGVEEI