Gene ID897
Gene NameHuta_0897
Annotationpyruvate flavodoxin/ferredoxin oxidoreductase domain protein
Locationchromosome:865451→867223
Gene typeFunctional gene
GC content0.66
Hydropathicity-0.279322033898305
DNA (1773 bp, Edit)ATGGTAAACGATCTCAATTGGGCCATCGGCGGGGAGGCTGGCGACGGGATCGACTCGACGGGCAAGATCTTCGCCCGGGCGCTCTCACGAGCGGGTCGCCACGTCTTCACGTCGAAGGATTTCGCCTCGCGCATCCGGGGCGGATACACCGCGTATAAAGTCCGGACGGCCGTCGAGCGCGTCGAGAGCGTGGTCGATCGCCTCGACATCCTGATCGCGCTCACCGAGCGGACCATCGACGAAAACCTCGACGAACTTCAGGAGGGCAGCGTCATCATCTACGACGGCGAGCAGACCACGATGGCTGACGTCGAGGTCCCCGACGGCATGATCGGGCTGGAAGTCCCGCTCAACAGTCTCGCCGAGGAGGCCGGCGGGGCGATCATGCGCAACGTCGTCGCCCTGGGCGCGGCCAGCGAAGTCGCTGACTTCCCCGTCGAATACCTCGACGAAGCCCTCGTCAAACGGTTCGGCGAGAAGGGCGAAGCCATCATCGCCAACAATCGCGAGGCGGCCCGTCTGGGCCGCGATTACGTCCGGGAAGAGACGGACTGCAGCCACGAGTTCGCCCTCGAAACGACCGACGAGGACTACGTCCTGCTGAACGGGGACGAGGCCATCGGCATGGCCGCGATCGCCGCCGGCTGTCGGTTCTACGCCGGGTATCCGATCACACCGGCGACGGACGTCATGGAGTACCTCACCGGCCGGATCGAGGCCTTCGGCGGCGCGGTCGTCCAGGCCGAGGACGAGTTGTCGGCGATCAACATGGCGCTGGGCGCGGCCAGGGCCGGCGCGCGGGCGATGACCGCCACATCCGGGCCGGGGATCGACCTGATGAACGAGACGTTCGGGCTGGTCGCCACCAGCGAGACGCCCCTCGTGATCGCGAACGTGATGCGTTCGGGGCCATCGACCGGGATGCCCACAAAGCAGGAACAGGGTGACCTGAACGCGATGCTCTATGGCGGCCACGGTGAGATCCCCCGGTTCGTCCTCGCGCCGACGACCATCGGGGAGTGTTTCGACCGGACCGTCGAGGCGTTCAACCTCGCCGAGAAGTACCAGATCCCGGTGTATCTCACCGCGGACCTCGCACTGGCTGTCACCGAGCAAACCTACTCGCCGGAGCGCTTCGACATGGAGGGCGTCGAGATCGACCGCGGAAAGGTGGTCGACGCCGACGAGGTCGGGGAGTGGCTCGACGAGAAAGGGCGCTTCAAGGCCCACGCCGCGACCGAGGACGGCGTCAGCCCGCGGGCGCTCCCGGGGACACCCGACGCCGCACACATGACGACGGGCCTCGAACACGACGAGTTGGGTCGCCGGACCGAAGAGGAGGACGTCCGCGTCGAACAGGTACAGAAGCGCCAGCGGAAGGTCGACACCGCCCGCGACCGGGAGGCCTTCGACTACCGGGAGTTCGGGGATAGCGATGCCGAAACACTCGTCATTTCGTGGGGTTCCAACGAGGGAGCGATGCGGGAAGCCCTGGGGATGCTCGACGATCGCGGGATCGACGTTCGGTTCCTCTCGGTGCCGTATATCTATCCGCGGCCTGATCTGACCGACGAGGTCGAGGCTGCGGAGGACGTTATCGTCGTCGAGTGCAACGCGACGGGGCAGTTCGCGGACTTAATCGAGCACGACACGCTGAGCCGCGTCCAGCGCGTCACGAAGTACACGGGCGTCCGATTCAAGGCCGACGAACTCGCCGACGAGATCGAAGGGGCGATCGCCGGCGAACGCGCCCCACAGGAGGTGAAACGATGA
pI4.1599
MW (k)64282.7
Translation (589 aa, Edit)MVNDLNWAIGGEAGDGIDSTGKIFARALSRAGRHVFTSKDFASRIRGGYTAYKVRTAVERVESVVDRLDILIALTERTIDENLDELQEGSVIIYDGEQTTMADVEVPDGMIGLEVPLNSLAEEAGGAIMRNVVALGAASEVADFPVEYLDEALVKRFGEKGEAIIANNREAARLGRDYVREETDCSHEFALETTDEDYVLLNGDEAIGMAAIAAGCRFYAGYPITPATDVMEYLTGRIEAFGGAVVQAEDELSAINMALGAARAGARAMTATSGPGIDLMNETFGLVATSETPLVIANVMRSGPSTGMPTKQEQGDLNAMLYGGHGEIPRFVLAPTTIGECFDRTVEAFNLAEKYQIPVYLTADLALAVTEQTYSPERFDMEGVEIDRGKVVDADEVGEWLDEKGRFKAHAATEDGVSPRALPGTPDAAHMTTGLEHDELGRRTEEEDVRVEQVQKRQRKVDTARDREAFDYREFGDSDAETLVISWGSNEGAMREALGMLDDRGIDVRFLSVPYIYPRPDLTDEVEAAEDVIVVECNATGQFADLIEHDTLSRVQRVTKYTGVRFKADELADEIEGAIAGERAPQEVKR