Gene ID895
Gene NameHuta_0895
Annotationcell division protein FtsZ
Locationchromosome:864500←863340
Gene typeFunctional gene
GC content0.67
Hydropathicity-0.279533678756477
DNA (1161 bp, Edit)ATGGACTCTATCATCGACGACGCCATGGAGGAGGCCGACGACGACCCCGAGGAGTCGCCGGTCGAGGGGAACGATGAACCGACAGACACCGCTGCCGAGGAGCCCGCGACGTCCGGCCAGATGACCGACGAGGAACTCGCCGACGTCGTCGAGGACCTCGAAACCAAGATCACGGTCGTCGGCGCGGGGGGCGCTGGCGGCAACACAGTCACCCGGATGATGGAGGAGGGGATCCACGGCGCGAAACTGGTCGCGGCCAACACCGACGCTCAGCACCTCGCCGACGAGGTCAAAGCCGACACGAAGATCCTGATCGGCAAGAAGCGCACCGGCGGTCGGGGGGCCGGCTCGGTGCCGAAGATCGGCGAGGAGGCCGCCCAGGAGAACATCGAGGACATCCAGCAGTCCATCGACGGCTCGGACATGGTCTTCGTCACCGCCGGTCTCGGCGGCGGGACGGGCACCGGCGCTGCGCCGGTGATCGCCCAGGCCGCCCAGGATTCGGGCGCGCTGACGATCTCGATCGTCACGATCCCCTTCACCGCGGAGGGCGAGCGACGGCGGGCCAACGCCGACGCCGGCCTCGAGCGCCTCCGTGCCGTCAGCGACACCGTGATCGTCGTCCCGAACGATCGACTCCTCGATTACGCGCCGTCGATGCCGCTGCAGGACGCCTTCAAGATCTGCGATCGCGTCCTCATGCGCTCGGTCAAGGGGATGACCGAACTCATCACCAAGCCCGGCCTGGTCAACGTCGACTTCGCCGACGTTCGCACGATCATGGAGAACGGTGGCGTCGCGATGATCGGCCTCGGCGAGTCCGACAGCGAGAACAAGGCCCAGGACTCGATCCGCTCGGCGCTTCGATCGCCGCTGCTCGACGTCGAGTTCGATGGCGCAAACAGCGCCCTCGTGAACGTCGTCGGTGGCCCGGACATGTCCATCGAGGAGGCCGAGGGCGTCGTCGAGGAGATCTACGACCGGATCGATCCGGACGCTCGGATCATCTGGGGCGCGTCGGTCAACCACGACTACGACGGCCAGATGGAGACGATGATCGTCGTCACGGGCGTCGAGAGTCCACAGATCTACGGCAAGAGCGAGGCCGAACGCGAGAAGGCCGCCCAGCGCATGGGCGACGACATCGACTACGTCGAGTAA
pI3.9029
MW (k)40769.2
Translation (385 aa, Edit)MDSIIDDAMEEADDDPEESPVEGNDEPTDTAAEEPATSGQMTDEELADVVEDLETKITVVGAGGAGGNTVTRMMEEGIHGAKLVAANTDAQHLADEVKADTKILIGKKRTGGRGAGSVPKIGEEAAQENIEDIQQSIDGSDMVFVTAGLGGGTGTGAAPVIAQAAQDSGALTISIVTIPFTAEGERRRANADAGLERLRAVSDTVIVVPNDRLLDYAPSMPLQDAFKICDRVLMRSVKGMTELITKPGLVNVDFADVRTIMENGGVAMIGLGESDSENKAQDSIRSALRSPLLDVEFDGANSALVNVVGGPDMSIEEAEGVVEEIYDRIDPDARIIWGASVNHDYDGQMETMIVVTGVESPQIYGKSEAEREKAAQRMGDDIDYVE