Gene ID892
Gene NameHuta_0892
AnnotationABC transporter related
Locationchromosome:862144←861146
Gene typeFunctional gene
GC content0.66
Hydropathicity-0.123192771084337
DNA (999 bp, Edit)ATGACTGCCATCGAGATCGACGGCCTCGGAAAGGAATACGGCGACCTGACAGCCCTCGATGGACTCGACCTCAGCGTCGAGACGGGCGAAGTCTACGGCTTTCTCGGCCCGAACGGGGCGGGGAAGTCGACGACGATCAACCTCCTGCTTGGCTTTCTCGATCCATCTTCGGGCTCGGCGACGGTGCTCGGCCACGATATCGAACGCGAGTCCCGAGCGCTTCGCCGGCGCATCGGTGTCCTGCCGGAAGCATTCTCGCCCTACGAACGGCTCACCGCCCGCGAACACGTCAAATACGCGGCCGATCTCAAGGACGTGGCTGTCGACCCGGACGTACTTCTCGACAGAGTGGGGCTCACCGAGGACGCATGGGACCGGTCTGCCGGTGGGTTCTCGACCGGGATGGAGCAACGGCTCGCGCTGGCCTGCGCACTCGTTGGTGATCCCGAGGTGTTGATCCTCGACGAACCCTCCTCCGGGCTCGATCCGCGCGGGATGGCCGAGCTGCGCGAGCTGATCCGCGAGGAAGCCGCCGACGGGACGACCGTCTTCTTCTCGAGTCACATCCTCTCGGAGGTCGAAGCCGTCTGTGACCGGATAGGGATTCTGGTCGACGGTGGCCTCGTGGCCGAGGGGACGATCGACGAACTCAGAGACGGGACCGAGACGCATTCGCCGCTGGACGTTCGCGTGGACGCGGTGCCGGAGGGCTTCGACCTCACCGATCTCGATGGCGTGGCCTCTATGAGCGTCGAGGACAGCACGCTCTCTGCGCTGGTGACCGACGCTGGCGCGAAGATCGAGGTCATCCGCCGGGTCGATCAGGTCGCCGAAATCCGGGACGTCATCTCCGAGCCGGCTTCCCTCGAGGCGCTGTTCGATCGCTACGCCAACGGGGACTCAGCGGCCGAGGGGATGGAGGACGCCGACGGGTCCAGCGACGACGCTGACGGATCGACCGAGGAGGCTGACGCTGGTTCCACGGAGGCGACAGCATGA
pI3.839
MW (k)34991.5
Translation (331 aa, Edit)MTAIEIDGLGKEYGDLTALDGLDLSVETGEVYGFLGPNGAGKSTTINLLLGFLDPSSGSATVLGHDIERESRALRRRIGVLPEAFSPYERLTAREHVKYAADLKDVAVDPDVLLDRVGLTEDAWDRSAGGFSTGMEQRLALACALVGDPEVLILDEPSSGLDPRGMAELRELIREEAADGTTVFFSSHILSEVEAVCDRIGILVDGGLVAEGTIDELRDGTETHSPLDVRVDAVPEGFDLTDLDGVASMSVEDSTLSALVTDAGAKIEVIRRVDQVAEIRDVISEPASLEALFDRYANGDSAAEGMEDADGSSDDADGSTEEADAGSTEATA