Gene ID1536
Gene NamekorA
Annotationoxoglutarate--ferredoxin oxidoreductase, alpha subunit
Locationchromosome:658895←657099
Gene typeFunctional gene
GC content0.503060656649972
Hydropathicity-0.315217391304348
DNA (1797 bp, Edit)ATGCCCGCGGACTTTAATTGGGCCATCGGCGGCGAAGCCGGCGATGGCATCGACTCGACGGGGAAGATCTTCGCTCAGGCACTCTCACGTGCGGGACGGCACGTGTTCACCTCGAAGGACTTCGCCTCCCGTATCCGTGGGGGCTATACGGCCTATAAGGTACGGACAGCCGTCGATCCAGTGCAGAGCGTCGTGGACAGACTAGATGTGCTCATTGCATTGACGCCACGCACTATCAAGGAAAATCATGATGAACTTCACGAAGGGTCCGTCATCATCTATGATGGTGAGCGGACAACAATGGAAAACGTTGAGATTCCAGATGGAATGGTCGGTCTTGACGTCCCACTAAAACGATTGGCTGAAGAAGCCGGTGGTGCGATTATGCGTAACGTCGTTGCGTTGGGTGCCGCATGTGCGGTCGCAGACTTTCCGATTGAAAATCTTGATAGCGCGCTTGAGAAGCGCTTTGGATCGAAGGGTCAGTCACTCGTCGAGAATAATAAGGAGGCTGCACGAAGTGGGCGCGATTATGTCGGTTCAGAGTATCACAACGAATTTGACTATAGTCTTGAGACGACAGATGCTGACTACGTGTTATTAAATGGTGACGAAGCAATTGGAATGGGAGCCATTGCTGCAGGATGTAAGTTCTATGCCGGGTACCCAATTACGCCAGCAACAAATGTAATGGAGTATCTAACAGGTCGAATTGAACAGTTTGGGGGACACGTTCTCCAAGCGGAAGATGAACTTTCGGCTATCAATATTGCATTGGGTGCCGCACGCGCCGGTGCACGAGCAATGACAGCGACATCAGGTCCGGGAATTGATTTGATGACAGAAACGTTTGGTCTTATTGGAACCTCTGAAACGCCACTTGTCATCGCCGACGTGATGCGGTCGGGCCCTTCAACTGGAATGCCAACTAAACAAGAGCAGGGAGATCTGAATATGCTGCTGTACGGCGGGCATGGCGAGATTCCTCGGTTTGTTGTTGCGCCGACAACAATCGCCGAGTGCTTTTGGAAGACAGTCGAAGCGTTCAATCTTGCTGAAAAATATCAAACACCGGTATACCTTGCGGCTGACCTTGCAATGGCGGTGACAGAACGGACATTCTCACCGGAAACATTCGATATGGACGACGTTGAGATTGAGCGTGGAAAGGTTGTTGATGAATCAACAATCGACCAGTGGCAGAATGAGAAGTCACAATTCCAACCACACGCACTCACTGATGATGGAATCTCGCCACGAGCGTTTCCTGGAACAACTGGCGGCGCACATATGTCAACAGGGCTTGAGCATGATGAACTCGGTCGGCGGACTGAAGACACAGATATGCGAGTTGAACAGGTGGATAAGCGGACACGGAAAGTCGAAACAGCACGTCGTGAAGAGGACCTGACACCCCGATCGTTTGGGAGTGAAGATGCCCCGAATCTCGTGATCTCATGGGGATCAAATGAGGGAGCAATGGTTGAAGCGATGAGTATTCTTGATGAGCGGGGTATTGACGTCCACTTCCTTTCAGTTCCGTATCTATTCCCACGGTATAACCTCACAGAAGCGATTGATGAAGCTGAGACGGTAATCGCTGTGGAGTGTAATGCAACCGGACAGTTTGCTAACGTGATTGAGCACGATGCACTTTCACGTGTTAATCGTGTGAATAAATACGATGGCGTACGATTTAAAGCAGACGAGCTTGCAAGCAAGATTGAACAGACAATCGATACTGCGAGTAGTGCGGGAACAAATGAAGAAACAGAAACAACGGAGATAACTCAATGA
pI4.2806
MW (k)65047.4
Translation (597 aa, Edit)MPADFNWAIGGEAGDGIDSTGKIFAQALSRAGRHVFTSKDFASRIRGGYTAYKVRTAVDPVQSVVDRLDVLIALTPRTIKENHDELHEGSVIIYDGERTTMENVEIPDGMVGLDVPLKRLAEEAGGAIMRNVVALGAACAVADFPIENLDSALEKRFGSKGQSLVENNKEAARSGRDYVGSEYHNEFDYSLETTDADYVLLNGDEAIGMGAIAAGCKFYAGYPITPATNVMEYLTGRIEQFGGHVLQAEDELSAINIALGAARAGARAMTATSGPGIDLMTETFGLIGTSETPLVIADVMRSGPSTGMPTKQEQGDLNMLLYGGHGEIPRFVVAPTTIAECFWKTVEAFNLAEKYQTPVYLAADLAMAVTERTFSPETFDMDDVEIERGKVVDESTIDQWQNEKSQFQPHALTDDGISPRAFPGTTGGAHMSTGLEHDELGRRTEDTDMRVEQVDKRTRKVETARREEDLTPRSFGSEDAPNLVISWGSNEGAMVEAMSILDERGIDVHFLSVPYLFPRYNLTEAIDEAETVIAVECNATGQFANVIEHDALSRVNRVNKYDGVRFKADELASKIEQTIDTASSAGTNEETETTEITQ