Gene ID349
Gene NameHuta_0349
Annotationintracellular protease, PfpI family
Locationchromosome:336986←336426
Gene typeFunctional gene
GC content0.59
Hydropathicity-0.187096774193548
DNA (561 bp, Edit)ATGGAAAGCAAACAACTCCTGATGATCGTCGGCGATTTCGGTGAAGACTACGAGATCATGGTACCGTTCCAGGCCCTGCAGGCCGTCGGCCACGAAGTCGACGCGGTCTGTCCCGAAAAGGAGGGCGAAGAGACGATCAAGACGGCGATTCATGATTTCCGTGGCGACCAGACCTATCTCGAAGAACGGGGCCACGATTTCGAATTGACCGCAACGATGGCCGACGTCGACCCGACCGAATACGACGGCCTGGTAGTTCCCGGTGGACGAGCTCCCGAATACCTTCGTGGATACGATGTGGTGATCGAAGCTGTCCAGCACTTTTTCGAGGCCGACAAACCAGTCGCCTCGATCTGTCATGGCCCCCAGATCCTCGCCGCAGCTGGCGTCCTCGATGGCTACGAAATGACGGCGTATCCGGCAGTCCGGCCGGAAGTCGAGGCTGCCGGCTGTTCGTGGGTTGACGGCGTCGTCCGGGACGACAATCTGGTGACTGGCCAGGCCTGGCCCGACCACCCCGAATGGATCGCGACGTTCCTTGAACTCCTCGAAGAACAATAA
pI3.8911
MW (k)20570.9
Translation (185 aa, Edit)MESKQLLMIVGDFGEDYEIMVPFQALQAVGHEVDAVCPEKEGEETIKTAIHDFRGDQTYLEERGHDFELTATMADVDPTEYDGLVVPGGRAPEYLRGYDVVIEAVQHFFEADKPVASICHGPQILAAAGVLDGYEMTAYPAVRPEVEAAGCSWVDGVVRDDNLVTGQAWPDHPEWIATFLELLEEQ