Gene ID345
Gene NameHuta_0345
AnnotationGCN5-related N-acetyltransferase
Locationchromosome:332846→333601
Gene typeFunctional gene
GC content0.63
Hydropathicity-0.603187250996016
DNA (756 bp, Edit)ATGAACATCCGGACTGCGACTCCAGCGGATACACCAGCGATCCGTGACGTCGCCAGACGATCGCTCCAGGCGTCATACGCACTGAGTCCACAAACGATTACCACCGGCATCGAGGAGTGGTACGGCGAAGCACAGCTCGAGGAGAGTCTCGACTCCGACGATCGCATCCTGCTGGTCGCAGACGTCGACGAACAGGTCGTCGCGTTCTCCGAGAGTACGTTGACCGCAGGTCGGCCCTGGGTCGTCGACGAGTCCGACCACGGGCGTGACGCCATGCTGCTGTGGCTACACGTCGACCCTGATTACCGTGGCGAGGGGATCGCGAGCACCCTCTTCGACGAGACGATCGGTCGACTCCGTGACGAAGGCGCGATGGCGATCCAGGGCCGCGTCCTGGCGAACAATCAGGACGGGACTGGATTCTTCGAGTCCAAGGGCTTCGAGCGGGTGGGTCGCACCGAGATCGAGATCGGCGGCCGGAATCAGATCGAGTACCGATACATCGCCGAGCAAACCGGGCTCGAACCGCTGGAGTCCGGCGGCGAAACGGTGTACGTCGATCACGACGAATCCGAGCGTGGGTCGACAGCGCAGTTTCACATCGTCTACGCCGACGACGACCGCCAGGACCGCTACGGCTACTACTGTGACAACTGTGGTGAACTTGCGAACGCGATGGACGCGATGGGACGCATCGAGTGCAACTCGTGTGGGAACCGGCGCAAACCCACCCGATGGGACGCGGCGTACCTGTAG
pI4.1556
MW (k)28065.7
Translation (250 aa, Edit)MNIRTATPADTPAIRDVARRSLQASYALSPQTITTGIEEWYGEAQLEESLDSDDRILLVADVDEQVVAFSESTLTAGRPWVVDESDHGRDAMLLWLHVDPDYRGEGIASTLFDETIGRLRDEGAMAIQGRVLANNQDGTGFFESKGFERVGRTEIEIGGRNQIEYRYIAEQTGLEPLESGGETVYVDHDESERGSTAQFHIVYADDDRQDRYGYYCDNCGELANAMDAMGRIECNSCGNRRKPTRWDAAYL