Gene ID344
Gene NameHuta_0344
Annotationmetal dependent phosphohydrolase
Locationchromosome:332593←331907
Gene typeFunctional gene
GC content0.63
Hydropathicity-0.458771929824562
DNA (687 bp, Edit)GTGGGTGTTGAAATCCGGGAGGCGCCAGTGTCGGCGGCGGAATTCGAGGAGATGAAGCGGTTCGTCCACGATTATCTCGAGGCCAGCGTCGAGAACGAACAGGCTGGCGGACGGATGCGGTGGTACCCCTGGCACTCCGCCGAGTACCGGTTCAACCACATCCTCAACGTGGTGGAACTCGCCACGGATATCGCCAAGCAGGAAGGGGCGGACGTGCAGGTCACACGAGTGGCAGCACTGTTTCACGACGTGGCGAAACTCGAAGCGGAGCAGGACGAACACGCAGCAGCCGGTGCCCGCATCGCCAAGGAGTTCCTGGAGACGCACAGTGATTATCCACAGTCGTTCGTCGAACAGGTCGTCGCCGCGATCGAGGACCACTCCTATCAGGGTGACCTCACCGACCTGCCGCTTGAGACCCGGTGTCTCATCGAGGCTGACGTCCTCGACAAGGTCGGTGCCAACGGGACGGCGCTGTTGCTGTTGCGCATGGGATATGAGTCACGGTCCCACGTCGACGCTCCGGAGATGGTCGAACGCGTCACCGAGCGGGGAACGGACGCTCGCGAGCGCATCGAGAGCGACACCGCCGAGAGCTACCTCCACCGCCGACTCAAGCGGGTGCGGTGGTTCAAGGAGTGGCTCGAAGAGGAGATCGCCGTGGTCGATGCCGAAAGCGAGGTCTGA
pI4.4294
MW (k)26014.9
Translation (227 aa, Edit)MGVEIREAPVSAAEFEEMKRFVHDYLEASVENEQAGGRMRWYPWHSAEYRFNHILNVVELATDIAKQEGADVQVTRVAALFHDVAKLEAEQDEHAAAGARIAKEFLETHSDYPQSFVEQVVAAIEDHSYQGDLTDLPLETRCLIEADVLDKVGANGTALLLLRMGYESRSHVDAPEMVERVTERGTDARERIESDTAESYLHRRLKRVRWFKEWLEEEIAVVDAESEV