Gene ID341
Gene NameHuta_0341
AnnotationRNA methylase, NOL1/NOP2/sun family
Locationchromosome:330221←329313
Gene typeFunctional gene
GC content0.66
Hydropathicity-0.424834437086093
DNA (909 bp, Edit)ATGGACGTGTTGCAGCGCTACGAGTCGCTTTTCGAGGACTGGTCCGGATTCCGTGCTGCCTGTCGCCGCCCGCTCCCGTCGGTCGTCCGCGTCAACACGCTCAAGACGACCGTCGAGCGGGCGAAGACAGCCCTGGAGACGGAGGGGATCACCTACGAGACGGTCGACTGGCACGACGGTTTGTTGCGGTTGCCGGACGACAATCCTGGATCGAACTGGCCGTACGTGCAGGGGTGGCTCCACGGTCAGGAGGAAGTCTCGGCACTGCCGCCGGTCGTGCTCGATCCCGACCCGGGTGATCGCGTCTGGGACGCCACGGCCGCACCGGGCAGCAAGACGACCCAACTCGCTGCGCTGATGGACGACGAGGGGGCAATCGTGGCGACGGACAACAACCTCGGTCGGCTGTCGGCGTTGCGGTCGAACGCCGAACGCCTCGGCGTCACAAATCTTGCAGTTACGAACGAGGACGCGCGCAACCACTCGCTGAAGCCGTTCGACGGCAGGCAATACGATCACGCACTCGTCGACGCGCCCTGCTCGTGTGAGGGGACGATCCGGAAGAACCCGGATGCACTGGCGCAGTGGTCGCTCGATCACGTTTCCGGCATCGCCGGTGCCCAGAAGGGGATCCTCCGGCGCGCCGTCGAGGTCACCAAGCCCGGCGGGACCGTTGTCTACTCGACGTGCACGTTCGCTCCCGAGGAGAACGAGGCCGTCCTCGACCACGCCCTCGAAGAGACCGATGCCCGGCTCGTCTCGAGCGACCTCCCGCTCGACAGTCGACCCGGCGTGACCGAGTGGGACGGCGAGACCTTCGATCCGAGCGTCCGGAAGGCCCACCGGGTCTATCCCCACCTCAATGACACGGGCGGGTTCTTCGTCGCGAAACTGGAGGTGCCAGCATGA
pI4.5644
MW (k)33021.7
Translation (301 aa, Edit)MDVLQRYESLFEDWSGFRAACRRPLPSVVRVNTLKTTVERAKTALETEGITYETVDWHDGLLRLPDDNPGSNWPYVQGWLHGQEEVSALPPVVLDPDPGDRVWDATAAPGSKTTQLAALMDDEGAIVATDNNLGRLSALRSNAERLGVTNLAVTNEDARNHSLKPFDGRQYDHALVDAPCSCEGTIRKNPDALAQWSLDHVSGIAGAQKGILRRAVEVTKPGGTVVYSTCTFAPEENEAVLDHALEETDARLVSSDLPLDSRPGVTEWDGETFDPSVRKAHRVYPHLNDTGGFFVAKLEVPA