Gene ID340
Gene NameHuta_0340
Annotationconserved hypothetical protein
Locationchromosome:329316←328780
Gene typeConserved hypothetical gene
GC content0.65
Hydropathicity-0.707303370786518
DNA (537 bp, Edit)ATGACCGACGGGAGCGCATCGAGCGACGCCGAACTCGGTGAGAACGACGGCGATCGATTCGACCGGTTGCCGGCGACAGAGGACGAGCGCGAGGTCCAGGGTCGACCGACCCGCCAGGATGTGCTCGACTACTGGGACGATCGCTTCGGCGTCCCGCCGGAGACGTTCGAGGAGCACACGTTCTGGGAGCGCGGCTCGGGCAAGATCTGGGTCTTCTACGGCGATCTTCCGTCGCCGGTCCACATCGAAGCGCTCGGCATGACCTTCCTTCGGACGCGCCAGGAACACTGGAAGCCGACGCTCGAAGCCGTCCAGCGCTTTGGACACCACGCCGAGACCTGCGTAATTCATCTCTCACGCGAGCAGGCCCGGACGTTCCTCGCGGGCGATGATCAAGCGATCGAGTGGGACGGCGACTGGGGGTACCTGATCGTGGCCCACAACCTCGCCGGCGAGGTCGAACCACTGGGCGTCGGGCTGTATATTCACGGCGAACTTCGGTCACAGGTGCCGAAAGGGCGACGACGGGAGTTGTAG
pI4.6038
MW (k)20386.5
Translation (177 aa, Edit)MTDGSASSDAELGENDGDRFDRLPATEDEREVQGRPTRQDVLDYWDDRFGVPPETFEEHTFWERGSGKIWVFYGDLPSPVHIEALGMTFLRTRQEHWKPTLEAVQRFGHHAETCVIHLSREQARTFLAGDDQAIEWDGDWGYLIVAHNLAGEVEPLGVGLYIHGELRSQVPKGRRREL