Gene ID339
Gene NameHuta_0339
Annotationprotein of unknown function DUF790
Locationchromosome:327267→328778
Gene typeHypothetical gene
GC content0.66
Hydropathicity-0.308151093439364
DNA (1512 bp, Edit)GTGCTGACGAAGGACCTGCTAGCCGTCTCCCGCGCTGGCGGCGGGTACCACCCAGAGTTCGTCGACGAGGGCCACCGGGACCTCGCGGCGCGAGTGATCGGCGTCTTTCAGGGCCACGTCGGCGAGCGCCGCGAGACACTCACCGATGCCCTGACGGAAGTCGAACGCGAGTCCGACGATTTCAAACTCGTCCGCGGGTTCGCCAAGCTCCTCGAACGCGACGCCACCTTCGAGACACGAGCACCCCTTCCGCCGGAGCGAGCGCGCCGTGCAGCCTTCGAGGCCGCCGAGTCGATCGGGGTGGTCACCGAAGGCGAACGAGCCCGTGCGCTCCAGCAGGCCGCCGACCGCCTCGGCAGCGACCGGGCCGCCATCGAATCGTCGCTGTACGCCGATCTCGACGCCCGACAGATACTCACAGAGTTCGACCGACAGTGGACACCGGCGGCGTTGCTCGAACAGTACAATCTCTCGCTGGCTCAGACGGCGCTGTTCGACGCAACCGCCATCCGGATCAGCTCCGCCGATCCGAAAGCACTCGTGCGTGCTGTCAAACGTCTCGGGCTGCTTTACGAGGTCCGAAAGACCGACGACGGAGCGCGGGAACTCCACGTGACTGGGCCCGATGCACTGTTCAAGTCGACCCGTCGGTACGGCACCCAGTTCGCCCGACTCCTGCGGAGCGTGGCGAAAACCGACGACTGGCGACTCGAAGCCACCATCGATGACGACGGGCGCGAGCGGACGATGACCCTCACCGACGCCGACGTCTCGGTGCCCGACGTCGACCCGATCGTCGAGCCCACCTACGACAGCGACGTCGAGGCCGACTTCGCCACCCGTTTCGCGTCGCTGGATCTCCCCTGGGACCTTCGTCGCGAACCCGAACCGCTCGAAGCCGGCGCGAGCGTCGCGATCCCCGACTTCGCCTTCGAATACCGCCACGGTGACTTCCGCGTGTTCTTCGAGATCATGGGCTTTTGGACGCCGGCGTACGTCGAGAAGAAACTCGCCCAGTTCGATACGATCGATGACGTCGAACTGCTGGTCGCCTACGACGAGAGCCTTGGCGTCGGCGAGGCGATCGAAGCCCGGGACCATCGGGCGATCCCCTACACCGGCTCGGTCCGAGTGAAGGACGTCCGGGACGCGCTCCGGCGCTACGAGACCGATCTCGTCGCCGCGAACGTGGCCGAGTTGCCCGCCGAACTCGAACCTGAAGCCGACGTCATCACGCTCGCCGAACTGGCCGAGACCCACGGCGTGAGCGAAGATGCCGTCGAGACGACGAGTTTTCCCGAACACGAGTTGGTCGGTCGGACGCTGGTTCGGCCGTCGATTCTTGCTGATCTGGCTCAGCGGATCGAACCCGAGATGACCCTTTCCGAGGCCGAAGCAGTCCTCGACGAGTACGGAATCGACGATGCCAGCGCCGTGCTTTCGCGGTTGGGCTATCGCGTCGAGTGGGAGGGGCTGGGTGGCGGCGTGATCCGCAGTCAGAAATCAGCCTGA
pI4.345
MW (k)55830.3
Translation (502 aa, Edit)MLTKDLLAVSRAGGGYHPEFVDEGHRDLAARVIGVFQGHVGERRETLTDALTEVERESDDFKLVRGFAKLLERDATFETRAPLPPERARRAAFEAAESIGVVTEGERARALQQAADRLGSDRAAIESSLYADLDARQILTEFDRQWTPAALLEQYNLSLAQTALFDATAIRISSADPKALVRAVKRLGLLYEVRKTDDGARELHVTGPDALFKSTRRYGTQFARLLRSVAKTDDWRLEATIDDDGRERTMTLTDADVSVPDVDPIVEPTYDSDVEADFATRFASLDLPWDLRREPEPLEAGASVAIPDFAFEYRHGDFRVFFEIMGFWTPAYVEKKLAQFDTIDDVELLVAYDESLGVGEAIEARDHRAIPYTGSVRVKDVRDALRRYETDLVAANVAELPAELEPEADVITLAELAETHGVSEDAVETTSFPEHELVGRTLVRPSILADLAQRIEPEMTLSEAEAVLDEYGIDDASAVLSRLGYRVEWEGLGGGVIRSQKSA