Gene ID335
Gene NameHuta_0335
AnnotationArsR family transcriptional regulator
Locationchromosome:324481→324753
Gene typeFunctional gene
GC content0.59
Hydropathicity-0.535555555555555
DNA (273 bp, Edit)ATGGCTGAACCTGACGAGGAAGACATCACAGATCTCCCGCCGAGTGCCAAACTCGTCTTCAAGGTCCTCGAATACAAGGGCCCGCTGACACAGAAGGGAATCGTCGAAGAATCGATGCTCTCGGCCCGCACAGTCAGATACGCGCTCGAACGGCTCGAAGAAGTCGATGTCGTCTCCGAGGACGTCTACTTCGCTGACGCCCGGCAGAACCTCTACGAGCTGACCACCGGCGACGACGCCACCGAGAAACAGGATCAGGCCGTCTCCGACTGA
pI3.8758
MW (k)10127.2
Translation (89 aa, Edit)MAEPDEEDITDLPPSAKLVFKVLEYKGPLTQKGIVEESMLSARTVRYALERLEEVDVVSEDVYFADARQNLYELTTGDDATEKQDQAVSD