Gene ID332
Gene NameHuta_0332
AnnotationPHP domain protein
Locationchromosome:322037←321264
Gene typeFunctional gene
GC content0.63
Hydropathicity-0.270038910505837
DNA (774 bp, Edit)ATGTACGATTACCACGTCCACACCACGTACTCCGATGGCTCCTTTCTTCCCCGGATGATCGACGCTGCCGAGCGGGCCGGCCTCGACGGTGTCGGCTTCGCGGATCACTGCAACGTCTTCGACGCCGAGGCCGATCAGGCCTACCGCGAGGCGTCCGGCTTCAACCTGGATCTGACCTACGAGCGCCGACGCCGGGCGATCGACCGGGCGCGCGAGCGGACGGACCTCCGGCTGTTCGACGCCGTCGAGATGGATTATCACGCGGCACGCGAGGAGGCGATCGAATCGTTCCTCGAGGACGCCGACTTCGAATATGCCATCGGTAGCGTCCACGCGATCGATGGAGTCAACGTCCACAACCAGTCATACTTCGCCGGCCTCTCCGAAACAGAGCGTGAAGCTGCCGTCGAGATGTACGTCGATCACCTGATTTCGCTGGTCGACTCGGAACTGTTCGAGATTGCCGCTCACGTCGATCTCGTCGAGCGAAACGAGGCCCTCCGTGGGCTGCTGACCGAGGATCACTACGGACGAATCGCCGATGCGTTCACTGATTCCCGGACTGTACCCGAGATCAACGCCGGCCGCGTGCTCGACGCCTACGGCGAGTTCCATCCGAGCGAGTCCTTCGCGGAACTGTTGGTCGACGCGGGCGTTTCCTTCACCATCGGGTCGGACGCCCACGCGCCCGGATCGCTGATCGACTGCAGCGAGGAACTTCGCGCGGTCCGTGAGGAGTGGCACCTGCCGATCGTCGAGTTGGATCTTGTCTGA
pI4.1562
MW (k)28853.7
Translation (256 aa, Edit)MYDYHVHTTYSDGSFLPRMIDAAERAGLDGVGFADHCNVFDAEADQAYREASGFNLDLTYERRRRAIDRARERTDLRLFDAVEMDYHAAREEAIESFLEDADFEYAIGSVHAIDGVNVHNQSYFAGLSETEREAAVEMYVDHLISLVDSELFEIAAHVDLVERNEALRGLLTEDHYGRIADAFTDSRTVPEINAGRVLDAYGEFHPSESFAELLVDAGVSFTIGSDAHAPGSLIDCSEELRAVREEWHLPIVELDLV