Gene ID330
Gene NameHuta_0330
Annotationmulti-sensor signal transduction histidine kinase
Locationchromosome:317150→319426
Gene typeFunctional gene
GC content0.6
Hydropathicity-0.39551451187335
DNA (2277 bp, Edit)ATGGACCGTTCTGTCTCCGATACTATCCGGATCCTCTGTGTGGACGACGAGCGCGACTTTCTGGAACTGACCGCGACCTTTCTCGAACGGGAGCAGCCTTATTTCACCGTCGAGACGGCACCGAGCGCGACTGCAGGACTTGACCGTCTTGGGGACGGAGCCTTCGATTGTGTCGTTTCTGATTACGAGATGCCCGGTGCAAACGGGATCGAGTTTCTCGAAACGGTGCGTGAATCCCACCCCGATCTCCCGTTCATTCTGTTCACCGGGCGAGGTTCGGAAGATATCGCAAGCGATGCCATCTCATCCGGCGTCACCGATTACCTCCAGAAGACCACTGGCTCGGACCAGTACACTGTGCTGGCGAACCGAATCAAAAATGCCGTCGAACAGACCCGATCACGGCGACTGCTCGCGCGCAGCCAAACGCGACTGCGCGAAGTCATCGATGCCATGCCCCACCTGGTGTATATCGTTGCTGAGGACGGGACGTATTTACTCGCCAATCAGGCATTGGCTGACTTCCACGAGACGACAGTCGAAGCGATCGAAGGGGCGACTGTCAGCGAGATTCTCGGGGACCAAGCCGCCGAGCAGTTTCGGGCCGATCTCACGGACGTGCTGGAGTCGAACACGTCAAAACGTGTGCCCGATGTCGAAATCACGTCCCCCAAGGAGAAGACTCACGTCTTCGAACCGCGCCTGTTCCCACACGACCTGGCGGACACGGACACGCGAGCCGTTCTCGGGATCGCCGTCGATCGTACCGAACGGGTCGATCGCGAACGGGAACACGAAGAGACAGACGTCCTGCTTTCGACGCTGTTCGATACGCTTCCGGTCGGCGTGCTGGCCGAGCACGAATCCCGACAGGTGCTTTCAGTCAACCAGCGACTGCTTGACCTGTTTGACGTCGACGAGTCACCGTCAGCCATCGTCGGGACAGACAGTGCGCACCTCAGCGCCAAGATGCGTGACCGACTCGTAGAATCTAGCCGATCGCTCCATCAGCTCGACGAGTCGCCCACCGCCCCTGAGTCGAACACAGATCGGCAACTCGATCTGGGTGATGGTCGCACTGTCGAACAGCACTATCAAACAGTCGACTTTCCGGACGGGATGGGGCATCTCTGGGTCTATCGAGACGTGTCCGAGCACACGAAACGCAACGCTGAGTTGAGCACCGTCGTCGACCGCCTCGAAGGCCTCCACGATGCCACCAGAGATCTCATCCGGGCTGACGATCGGGAAACGGTTGGGACACTCGTGGCTGACTCGGTGAGTTCGATCCTCGACCACCCGAGTAACGTGGTTCGGTTCCGTGAGGGTGACGTCCTCCGACCGGTCGCCGTGACCAGCGACGCCAGGGCGGAACTCGGCGATCGCCCCTCGTATGCGATCGGCGAAGGCTTCCCGGGAGACGTGTATCGGACTGGCGAATCCCGCCTCGTCGAAGACTTCGAGGCGTGCGATCGAGGCGTCGACAATGGCCCACACCGCTCAGCGCTATATGTCCCGATCGGCGATCACGGAACACTGTCGATTGGAAACACTGAACAGGGTGCGTTCGGTCGGGTGGACCGAATGCTTGCGACGGTCCTCGCAGACAACGCGGCGACTGTCCTCGACCGCTTGACCGGCGAACGGACGCTCAAACGCCAGAACGAACGGCTTGCGGAGTTCGGACGGGTCGTGAGCCACGACTTGCGAAACCCGCTCGAAGTGGCACGAACACGCTGTCAACTGGCTATCGAAGATTGTGACCACAGTCATCTAGATGCGGTCGAACGGGCCCACGAACGCATGGAGACGTTGATCGACGATCTGCTGGTGCTAGCTCAAAACGGAGCGACCATCGCCGAGCCGGAGTGGCTCGATTTCGCGACGCTTGTCGATCGGTGTTGGACAACTGTCAGGACAGCCGACGCGACGCTCGAAAACGAGGCCGACGGACGGATCTGCGGCGACGAGAATCGGCTCCGACAACTGCTCGAAAACCTGTTCCGTAACGCGGTCTCTCACGGCGGGGAGACAGTGTGCGTCCGGATCGAAACCACAGACTGCGGGTTTTGTGTGGCCGACGACGGGCCGGGCATTCCGGTTGCGGACCGTGAGCGTGTCTTCGATGTGGGCTACTCGACCAGGGATGCGGGGACCGGATTCGGCCTCAGTATCGTCTCACAGGTGGCTGATGCTCACGGCTGGGACGTGACGGTGACTGAAAGCGATCGTGGTGGGGCACGGTTCGAGTTCACTGACGTCGAGATCGAACCGTAG
pI4.3144
MW (k)83847.6
Translation (757 aa, Edit)MDRSVSDTIRILCVDDERDFLELTATFLEREQPYFTVETAPSATAGLDRLGDGAFDCVVSDYEMPGANGIEFLETVRESHPDLPFILFTGRGSEDIASDAISSGVTDYLQKTTGSDQYTVLANRIKNAVEQTRSRRLLARSQTRLREVIDAMPHLVYIVAEDGTYLLANQALADFHETTVEAIEGATVSEILGDQAAEQFRADLTDVLESNTSKRVPDVEITSPKEKTHVFEPRLFPHDLADTDTRAVLGIAVDRTERVDREREHEETDVLLSTLFDTLPVGVLAEHESRQVLSVNQRLLDLFDVDESPSAIVGTDSAHLSAKMRDRLVESSRSLHQLDESPTAPESNTDRQLDLGDGRTVEQHYQTVDFPDGMGHLWVYRDVSEHTKRNAELSTVVDRLEGLHDATRDLIRADDRETVGTLVADSVSSILDHPSNVVRFREGDVLRPVAVTSDARAELGDRPSYAIGEGFPGDVYRTGESRLVEDFEACDRGVDNGPHRSALYVPIGDHGTLSIGNTEQGAFGRVDRMLATVLADNAATVLDRLTGERTLKRQNERLAEFGRVVSHDLRNPLEVARTRCQLAIEDCDHSHLDAVERAHERMETLIDDLLVLAQNGATIAEPEWLDFATLVDRCWTTVRTADATLENEADGRICGDENRLRQLLENLFRNAVSHGGETVCVRIETTDCGFCVADDGPGIPVADRERVFDVGYSTRDAGTGFGLSIVSQVADAHGWDVTVTESDRGGARFEFTDVEIEP