Gene ID313
Gene NameHuta_0313
AnnotationPAS/PAC sensor signal transduction histidine kinase
Locationchromosome:299623←297881
Gene typeFunctional gene
GC content0.58
Hydropathicity0.156724137931035
DNA (1743 bp, Edit)ATGGCGCTGGTCTGGGCAACGTACGTCCTCGTTCTCGTTGTCACGGTCCCAGTCCAGGTCTCGCTGGCATATTGGGTTTTCGCGCATCACGACGACGTTCGCGGTTCGCGGTGGTTTGCCTTCTCACTGTTTCTCGGATTCGTCTGGGCAATATTTCAATTTGTGATGTTCGTCGTCGCCGATCCGGAGATACAGTGGATCGTCCGGACGTTCGCCGAGAAAACCGCAATGGGTTCGTTCATGGCGTGGATCGTGTTCGCGTCACTGTATTCGGGCAGCGACTTTCATCGCCACTGGTTAGCCAGGGCCGGGTTGGGCTATCTCATCATCAACGCCCTGACCCCATCGTTCGTCAGTCCCTTCTCGGAGTTGTTCTACGAACAGCGGGTTGTCATCGCTGAGCCGTTTCAGTACGTGACCGTCGAACCAGGACTCGTGTATCTCTCGGCTCTCCTGGTTATAGTTGTCCTTGGCGGGGCGGGGATGACTGCACTGGTGCGGTATCTCCTCTCTACACCCAGAGACAGCGGGTATCCACTCGTGTTGCTCGTTCTCGGTGCGCTCTCGATACCGCTGTTCACGATCAGCGGGAAACTCGGTCTCTTCCCAGCGACACAGCTCAACCACTCGACGTACGGATTGTTACCGTTCAGTCTCTTCATGACGTTTGCACTGTTCCGATTTCGGCTGTTCGACATCCAGCCAGTCGCTCGGAACGCAGTCGTCGAGGAGCTGCAGGATCCCGTGTTTGTCCTCGAGGCCGATCGGTGCCTGGTTGATTATAATCAGGCAGCGAAACGTCTGGTTCCGGCCGTCGAGAGCGGCGTTGGCCAGCCATTCGACGCCGTCTTTCCGGCACTCGGTGAGTCATTAGTTTTTCCTGAACACGAGGCGGAAACGACGACCGAAATTTCGATGACGACAAACGACAGGACGCGTCATTATTCGGTGAACGTCTCACAGGTCGGCGGACAGAGCCAGGCACACGCGAACTGGTACTCGGTGGTGCTTCGGGACGTGACTGAACTGGAACGCTCCCGAAGTCAACTCCAGGCCCAGAACGAACGCCTCGATCAGGTTGCAAGCACGATCTCTCACGATCTTCGAAACCCGATTCAGGTGGCTCTCGGCAATACTGAACGGATCCGGACGTGTCTCGGACCCAGCGAGATCGAATCCGGGGACCGTCACACGGTGCTTGACGCGGTCGATACCACGCAAGCCTCACTTGAGCGGATGGAGGATATCCTCTCTGACCTGCTGACCATCGCCCGCGAGGGCAAAACTATCGAGGACGCCGAGTCACTCTCGCTTGCAGCCGTCGCCAGCGACGCCTGGCAAACCGTCGATACGAGATCCGCATCGTTGACGGTCGCCGAAGACACCACGGTACAGGCAGACCGGAGCAAACTTCGCTCCATCCTCGAGAACCTCTTTCGGAACAGTGTCGAACACGGGCCCGACGATGTGACGGTCACGATCGGATCGATCGACGGCGGGTTCTTCGTTGCTGATGACGGTCCAGGGATCGATCAATCAGCGACCGACAAGATCTTCGAATACGGGTATACGACAAGCGACGAGGGGACCGGTCTTGGGCTCTCTATCGTCCGAACGATGGCCGAATCCCATGGCTGGTCGGTTCACGCGGAACCAGGCGACACCGGTGGGGTCCGGTTTGTGTTTGCAAGTGTTTCCAGCACTCGGGCCGATCGAATCGCCAGCGAGCCTCATTCGCAGTGA
pI4.5525
MW (k)63814.3
Translation (579 aa, Edit)MALVWATYVLVLVVTVPVQVSLAYWVFAHHDDVRGSRWFAFSLFLGFVWAIFQFVMFVVADPEIQWIVRTFAEKTAMGSFMAWIVFASLYSGSDFHRHWLARAGLGYLIINALTPSFVSPFSELFYEQRVVIAEPFQYVTVEPGLVYLSALLVIVVLGGAGMTALVRYLLSTPRDSGYPLVLLVLGALSIPLFTISGKLGLFPATQLNHSTYGLLPFSLFMTFALFRFRLFDIQPVARNAVVEELQDPVFVLEADRCLVDYNQAAKRLVPAVESGVGQPFDAVFPALGESLVFPEHEAETTTEISMTTNDRTRHYSVNVSQVGGQSQAHANWYSVVLRDVTELERSRSQLQAQNERLDQVASTISHDLRNPIQVALGNTERIRTCLGPSEIESGDRHTVLDAVDTTQASLERMEDILSDLLTIAREGKTIEDAESLSLAAVASDAWQTVDTRSASLTVAEDTTVQADRSKLRSILENLFRNSVEHGPDDVTVTIGSIDGGFFVADDGPGIDQSATDKIFEYGYTTSDEGTGLGLSIVRTMAESHGWSVHAEPGDTGGVRFVFASVSSTRADRIASEPHSQ