Gene ID310
Gene NameHuta_0310
Annotationchaperone protein DnaK
Locationchromosome:293642→295576
Gene typeFunctional gene
GC content0.65
Hydropathicity-0.54503105590062
DNA (1935 bp, Edit)ATGGCGAGCAACAAGATTCTCGGAATCGACCTGGGAACGACCAACTCAGCGTTCGCAGTGATGGAGGGTGGCGACCCGGAGATCATCGTCAACAGCGAAGGCGATCGGACGACGCCCTCGGTCGTGGCGTTCGACGACGGCGAGCAACTCGTCGGCAAGCCGGCGAAGAACCAGGCCGTCAAGAACCCTGATGAGACGATTCAGTCGATCAAGCGTCACATGGGCGAGGAAGACTACACCGTTTCCCTGGACGGTGAGGAGTACACGCCCGAGCAGGTCTCGGCGATGATCCTCCAGAAGATCAAACGCGACGCCGAGGAGTACCTCGGTGACGAGATCGAGAAGGCCGTCATCACCGTCCCGGCGTACTTCAACGACCGCCAGCGCCAGGCCACGAAGGACGCCGGCGAGATCGCCGGCTTCGAAGTCGACCGCATCGTCAACGAGCCGACAGCGGCCTCGATGGCCTACGGGCTCGACGACGAGTCCGACCAGACGGTGCTCGTCTACGACCTGGGTGGCGGGACGTTCGACGTCTCGATTCTCGACCTCGGTGGCGGCGTCTACGAAGTCGTCGCGACCAACGGTGACAACGACCTCGGTGGCGACGACTGGGACCGGGCGATCATCGACTGGCTGGCCGAGGACTTCGCCGAGGAGCACGGCATCGACCTCCGGGAGGACCGCCAGGCCCTCCAGCGGTTGAAGGACGCCGCCGAGGAAGCCAAGGTCGAACTCTCCTCCCGGAAAGAGACCGAGATTAACCTGCCATTTATCACCTCTACTGACGACGGTCCGGTCCACCTGGAGACGGACATCACCCGCGCGAAGTTCGAGAGCCTGACGAGTGACCTGATCGAACGCACCGTCGAGCCGACCGAGCAGGCTCTTGAGGACGCCGACTACTCGAAGTCGGATATCGACGAGGTGCTGCTTGTGGGCGGATCGACCCGCATGCCCCAGGTTCAGGAGAAGGTCGAGGAACTCACCGGCCAGGAACCGAAGAAGAACGTCAACCCCGATGAGGCCGTCGCGCTGGGCGCGGCGATCCAGGGCGGGGTCCTCTCGGGCGACGTCGACGACATCGTCCTGCTCGACGTGACGCCCCTCAGCCTCGGTGTCGAGGTCAAGGGCGGCCTCTTCGAGCGTCTGATCGAGAAGAACACGACGATCCCGACCGAGGAGTCGAAGATCTTCACCACCGCCGCGGCCAACCAGACCTCGGTCCAGATCCGCGTCTTCCAGGGCGAACGCGAGATCGCCGAGGAGAACGAACTGCTTGGAGCCTTCATGCTGCAGGGCATCCCGCCGGCTCCGGCCGGGACGCCCCAGATCGAGGTCACCTTCTCGATCGACGAGAACGGCATCGTCAACGTCTCAGCCGAGGACCAGGGCTCGGGCAACTCCGAGGAGATCACCATCGAGGGTGGCGTCGGCCTGAGCGACGAGGAGATCGAGGAGATGCAGGAGGAAGCCGAGGAACACGCCGAAGAGGACCAGCAGCGCCGCGAGCGCATCGAGGCCCGCAACGAGGCCGAGAGCGCCATCCAGCGCGCCGAGACGCTGCTGGAGGAGAACGAGGATGCTGTCGACGATGACCTCCGTGAGGACATCGAATCCGAGATCGAAGCGGTCCAGGAAACCCTCGACGACGACGATGCGACCAAGGAGGATTACGAGCAAGCGGTCGAGGCGCTCACCGAATCCCTCCAGGAGATCGGCAAACAGATGTACGACCAGGCTGGCGCGGAAGGTGCTGCAGGCGCTGGTGCGGCCGGTGCAGGTGCCGGTGGCATGGGCGGCATGGGCGGCGCTGGTCCCGCAGGCGCGGGTGGCCCCGCCGGTGGGCCGGGCGGCGCTGGCGACGAAGCTGGCGAGGAGTATGTCGACGCCGACTTCGAAGAGGTCCAAGACGAAGACGACGAAGACGAGTAA
pI3.6769
MW (k)69034.8
Translation (643 aa, Edit)MASNKILGIDLGTTNSAFAVMEGGDPEIIVNSEGDRTTPSVVAFDDGEQLVGKPAKNQAVKNPDETIQSIKRHMGEEDYTVSLDGEEYTPEQVSAMILQKIKRDAEEYLGDEIEKAVITVPAYFNDRQRQATKDAGEIAGFEVDRIVNEPTAASMAYGLDDESDQTVLVYDLGGGTFDVSILDLGGGVYEVVATNGDNDLGGDDWDRAIIDWLAEDFAEEHGIDLREDRQALQRLKDAAEEAKVELSSRKETEINLPFITSTDDGPVHLETDITRAKFESLTSDLIERTVEPTEQALEDADYSKSDIDEVLLVGGSTRMPQVQEKVEELTGQEPKKNVNPDEAVALGAAIQGGVLSGDVDDIVLLDVTPLSLGVEVKGGLFERLIEKNTTIPTEESKIFTTAAANQTSVQIRVFQGEREIAEENELLGAFMLQGIPPAPAGTPQIEVTFSIDENGIVNVSAEDQGSGNSEEITIEGGVGLSDEEIEEMQEEAEEHAEEDQQRRERIEARNEAESAIQRAETLLEENEDAVDDDLREDIESEIEAVQETLDDDDATKEDYEQAVEALTESLQEIGKQMYDQAGAEGAAGAGAAGAGAGGMGGMGGAGPAGAGGPAGGPGGAGDEAGEEYVDADFEEVQDEDDEDE