Gene ID2194
Gene NameasnC4
AnnotationAsnC family transcriptional regulator
LocationI:2120931←2121422
Gene typeFunctional gene
GC content61
Hydropathicity-0.386503067484663
DNA (492 bp, Edit)ATGGCCGACGCGGAGTACCCTATCGACGATCTGGACCGGAACATCATCTACGCGCTCCAGCAGGATGCGAGACACACGTCGGCGAGTGAGATCGCTGAATCGCTTGACGTCTCCGCACGAACTGTTCGGAATCGCATCACAAAGCTCGAAGAGGCCGGCGTTATCGCCGGCTACGATGTCGATGTCGATTACGAGGCCGCGGGGTACCAGCTCCATACGCTTATCGTCTGTACGGCACCGATCCACGAGCGCGAGGAGGTCGCACAGCGGGCGCTCGACGTGTCCGGCGTCGTTGCCATCCGGGAGGTCATGACCGGGGCCGACAACGTCCACGTCGAGGTGGTCGGAACCGACGGGAACGACCTGAGCCGAATCGGCAGGGACCTCAACGATATCGGACTGGAGGTCGTCGACGAGGACCTTATTCGGAACGAGTACACCCGGCCGTTCCACCAGTTCGGGCACGACGATACCGAGGGTGAGTCTAAATAG
pI4.1283
MW (k)18051.8
Translation (162 aa, Edit)MADAEYPIDDLDRNIIYALQQDARHTSASEIAESLDVSARTVRNRITKLEEAGVIAGYDVDVDYEAAGYQLHTLIVCTAPIHEREEVAQRALDVSGVVAIREVMTGADNVHVEVVGTDGNDLSRIGRDLNDIGLEVVDEDLIRNEYTRPFHQFGHDDTEGESK