Gene ID2184
Gene NamegatB
Annotationaspartyl/glutamyl-tRNA amidotransferase subunit B
LocationI:2110778→2112295
Gene typeFunctional gene
GC content65
Hydropathicity-0.553861386138613
DNA (1518 bp, Edit)ATGACTGCGCAAGCGTCCGAAGCCCGCGAACTCGCGGCCGTCATCGGGCTGGAGGTCCACGTCCAGCTCGAGACGGAGACGAAGATCTTCTGTGGCTGTTCGACCGATGTGGCCGATTCCGAACCCAACACCCACACCTGCCCGGTGTGTCTGGGACTACCCGGCGCGCTCCCGGTCGTCAACGAGGGGGCGGTCGAGGCCGCCGTGAAGGTCGGCAAGGCCATCGACGCCGATATTCCGGAGGAAACCACCTTCCACCGGAAGAACTACTACTACCCCGACCTCCCAAAGAACTTCCAGATCACGCAGTATGACTCGCCCATCTGCCAGGACGGGGAGCTGGAATTCTCCGTCGAGAGCGAGCGCCGCAGCGTCGACATCCGCCGGGCACACCTCGAAGAGGACCCCGGGTCAATCAAGCACGTCCGCGAGGGCTCGGGTCCGCTTGAGTCCCGGACCTGTTCCATCGAGCGCGCGGACTACACGCTCATCGACTACAACCGCGCCGGGACGCCGCTGATGGAGATCGTCACGGAGCCGGACTTCCGTGCGCCGGGCGAGGTCCGGTCGTTCCTCGAAAAACTCGAAGAAGTGCTTGAGTATCTGGGCGTGTTCGACGCGACGCGGGATGGCAGTCTCCGCATCGACGCGAACCTCTCAATGGTCGACGCCAGCGAAGTTGGCGAAGACGGCGACATCGACAAGTCCGTCCTCGAAGACGCCAACCGCACCGAGGTCAAGAACATCTCCAGTCACAAGGGCGCGGAACAGGCGCTCTCCTTCGAGGCCTCCCGCCAGCGGAAGCTCATCCAGTCGGGCCGCGCCGTCGAGCAGGAGACCCGCCACTTCAACGAAACGCACGGCAACACGGTGTCGATGCGCTCGAAGGAAGAGGAGAAAGACTACCGCTACTTCCGGGAGGCCGACCTGCCGCCGCTTCGCGTGAGCCACTGGAAGGACGAGGTCCCGATTCCGGAACTCCCCGACGCCCGCCGCGAGCGGTTCGTCGCGGAGTACGGCCTCAGCGAGGAAGCCGCCTCGAAGCTCACGAGCACGAAGCAGGTGGCGGACTTCTTCGAGGACGTGGCCGAGCGCTTCGACGCCGACCTCGCTGCGACCTGGGTCGCCGATAATCTACTCGGCGAACTGAACTACCGCGACATGGCCATCACCGATATCGACGACCGCTTCGACGAGGTGACCCGGCTCGTCGAACTCGTCGCCGAGGACGATATCACGGCGAAAAACGCGCACGAGACCGTGCTCCGGGAGATGCTCGACACGGGTGACGGCCCCGACGCTGTCGTCGACCGCGAAGGGCTTGGCAAGACCTCCGGCGACGAGGTCCAGCAGGCTGTCGTGGACGCCATCGACGAAAACCCCGACGCCGTCGAGGACTACCACAGCGGCGAGGACGGCGCAATCAACTTCCTCGTCGGGCAGGTCATGCAAAAGACCGGCGGGAGCGCCGACCCCGGCGACGTGAACGGGCTGCTTCGCGAGGAGTTGGAGAGCTAA
pI4.1531
MW (k)55962.6
Translation (504 aa, Edit)MTAQASEARELAAVIGLEVHVQLETETKIFCGCSTDVADSEPNTHTCPVCLGLPGALPVVNEGAVEAAVKVGKAIDADIPEETTFHRKNYYYPDLPKNFQITQYDSPICQDGELEFSVESERRSVDIRRAHLEEDPGSIKHVREGSGPLESRTCSIERADYTLIDYNRAGTPLMEIVTEPDFRAPGEVRSFLEKLEEVLEYLGVFDATRDGSLRIDANLSMVDASEVGEDGDIDKSVLEDANRTEVKNISSHKGAEQALSFEASRQRKLIQSGRAVEQETRHFNETHGNTVSMRSKEEEKDYRYFREADLPPLRVSHWKDEVPIPELPDARRERFVAEYGLSEEAASKLTSTKQVADFFEDVAERFDADLAATWVADNLLGELNYRDMAITDIDDRFDEVTRLVELVAEDDITAKNAHETVLREMLDTGDGPDAVVDREGLGKTSGDEVQQAVVDAIDENPDAVEDYHSGEDGAINFLVGQVMQKTGGSADPGDVNGLLREELES